Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 82 showing 1621 ~ 1640 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00036972

http://www.wormbase.org/db/get?name=WBStrain00036972

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001423(fib-1)
Genomic Alteration: WBGene00001423(fib-1)
Availability: available
References:
Synonyms: fib-1(ok2527) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1927, CGC_VC1927
Notes: T01C3.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2527 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTCCGACGAGGAGAAGTG. External right primer: GCTTCCTCGTTATTTGCAGC. Internal left primer: AAGGTCTGAACCGATTGCAC. Internal right primer: TGCTACATATGCCGATTCCA. Internal WT amplicon: 2241 bp. Deletion size: 1271 bp. Deletion left flank: GGCAAGGTTGAGAACCAAGTAAAGATAAAA. Deletion right flank: AAAAATCCTGAAATTCAGTTTACCTCCGCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036972 Copy   


  • RRID:WB-STRAIN:WBStrain00036973

http://www.wormbase.org/db/get?name=WBStrain00036973

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013383(aptf-2)
Genomic Alteration: WBGene00013383(aptf-2)
Availability: available
References:
Synonyms: Y62E10A.17(gk902) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1928, CGC_VC1928
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y62E10A.17. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk902 homozygotes (mostly sterile; eggs sometimes hatch but larvae are abnormal and arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTCAGTTGGCGTCTCTG. External right primer: TCTCGTCGTCTCATCCCTCT. Internal left primer: AACCCGTTGAGACACGATTC. Internal right primer: CCATTCCATTACTTGGCACA. Internal WT amplicon: 2267 bp. Deletion size: 1096 bp. Deletion left flank: TGCTGACATACATTCTCTGAAATATTTGGA. Deletion right flank: TTTTTCTGTGCCGCACTTTGGTTTTTTTTA."

Proper citation: RRID:WB-STRAIN:WBStrain00036973 Copy   


  • RRID:WB-STRAIN:WBStrain00036976

http://www.wormbase.org/db/get?name=WBStrain00036976

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00006802(unc-69)|WBGene00011558(ostf-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006802(unc-69), WBGene00011558(ostf-4)
Availability: available
References:
Synonyms: T07A5.5&unc-69(ok2448) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1932, CGC_VC1932
Notes: T07A5.6, T07A5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2448 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACGTGTAACCACTTCTCGCC. External right primer: CTTCATCGATCGGCTTTTGT. Internal left primer: CGGCTGTGAACTCATGACATA. Internal right primer: ATTCAAAGCTCGAGCCAAAA. Internal WT amplicon: 2903 bp. Deletion size: 1464 bp. Deletion left flank: GAGCATGAGCATCGCGATTCCAAGAATGTT. Deletion right flank: ATATTTAGTGTAGTAAAACTGTTACGAGTG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036976 Copy   


  • RRID:WB-STRAIN:WBStrain00036975

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036975

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006829(unc-101)|WBGene00010537(mys-2)
Genomic Alteration: WBGene00006829(unc-101), WBGene00010537(mys-2)
Availability: available
References:
Synonyms: K03D10.3(ok2429)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC1931, CGC_VC1931
Notes: K03D10.3. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2429 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACTGTTTGAACTCACCCCG. External right primer: AAATTTCCGGTTTTCTGGCT. Internal left primer: TAAAAATTGGGTGAGGCTCG. Internal right primer: TACGGGAAAAACTGCCAAAA. Internal WT amplicon: 3157 bp. Deletion size: 2168 bp. Deletion left flank: AACTGTAATTTACGGTGTTTTATATCGAAT. Deletion right flank: GCATTTAAATCGATTTTTCCCATAAAATCC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036975 Copy   


  • RRID:WB-STRAIN:WBStrain00036989

http://www.wormbase.org/db/get?name=WBStrain00036989

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004064(pms-2)
Genomic Alteration: WBGene00004064(pms-2)
Availability: available
References:
Synonyms: pms-2(ok2529) V.
Alternate IDs: WB-STRAIN:VC1953, CGC_VC1953
Notes: H12C20.2. External left primer: ATTCGGCTCGATCAGGTAAA. External right primer: TGAAAGAAAACGTGTGCGAG. Internal left primer: GGTTGATCTAGCTTCGCCAG. Internal right primer: GAACATGTCGAATGAGGCAA. Internal WT amplicon: 2942 bp. Deletion size: 2158 bp. Deletion left flank: CATCTGATTAGGATATTGTGATACCACTGC. Deletion right flank: TAGCAGCAGATTGACGGCAAATGATATTTC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036989 Copy   


  • RRID:WB-STRAIN:WBStrain00036902

http://www.wormbase.org/db/get?name=WBStrain00036902

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00021163(nhr-275)
Genomic Alteration: WBGene00021163(nhr-275)
Availability: available
References:
Synonyms: nhr-275(gk860) V.
Alternate IDs: WB-STRAIN:VC1823, CGC_VC1823
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y5H2A.2. External left primer: TCCCAAAAGCTCATGGATTC. External right primer: CAAAGCTGAATGTTGGCTGA. Internal left primer: AAGTTGCCACCAATTTCTGC. Internal right primer: CGTGTCACGCAATGGTTAAG. Internal WT amplicon: 1964 bp. Deletion size: 337 bp. Deletion left flank: TGCCAATTTGCCGATTTGCCGGAAATTTCA. Deletion right flank: CCTGAAAAACGCCGCACAGGCTCGGCATGT."

Proper citation: RRID:WB-STRAIN:WBStrain00036902 Copy   


  • RRID:WB-STRAIN:WBStrain00036905

http://www.wormbase.org/db/get?name=WBStrain00036905

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00006509(tag-164)|WBGene00012097(abcf-2)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006509(tag-164), WBGene00012097(abcf-2)
Availability: available
References:
Synonyms: tag-164&abcf-2(ok2388) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1828, CGC_VC1828
Notes: Made_by: Anna Rankin|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y76A2A.1, T27E9.7. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2388 homozygotes (small, sickly, tends to die out but populations are possible to maintain). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGCAGTTGATAGCCTCG. External right primer: CGTCGCTTTTTCCGTGTATT. Internal left primer: ATAGCTGTTTCATCGGGCAC. Internal right primer: AATTTAGGGTACCCCATCCG. Internal WT amplicon: 3031 bp. Deletion size: 1245 bp. Deletion left flank: CAGGCTAAATTAGCATATTTACACAGACGA. Deletion right flank: CCGCTTGAAGAGCAGTTTTCTCTGAAGCAG."

Proper citation: RRID:WB-STRAIN:WBStrain00036905 Copy   


  • RRID:WB-STRAIN:WBStrain00036904

http://www.wormbase.org/db/get?name=WBStrain00036904

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001063(dpy-1)|WBGene00004314(rbc-2)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00004314(rbc-2)
Availability: available
References:
Synonyms: rbc-2(ok2313)/sC1 [dpy-1(s2170)] III.
Alternate IDs: WB-STRAIN:VC1827, CGC_VC1827
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y54F10AM.10. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2313 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGGCGACTTTTCAC. External right primer: AGGGGGAACTGTCGGTTAGT. Internal left primer: TACAAATCCCCGTCCCAATA. Internal right primer: AGAAGTCGAGGTGGCAGGTA. Internal WT amplicon: 3304 bp. Deletion size: 2261 bp. Deletion left flank: GCGATAATTTGTTGTTTTTACTGAAAATTT. Deletion right flank: TCGAGGGTGGCTACTGTATTCTCGCGGAGA."

Proper citation: RRID:WB-STRAIN:WBStrain00036904 Copy   


  • RRID:WB-STRAIN:WBStrain00036907

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036907

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004357(rho-1)
Genomic Alteration: WBGene00004357(rho-1)
Availability: available
References:
Synonyms: rho-1(ok2418) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1830, CGC_VC1830
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y51H4A.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2418 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGGAGAGGAGATGTGTGAT. External right primer: GCAAATCCAGGTTTTTCCCT. Internal left primer: ATTGGAATAGAGAAGCGCGA. Internal right primer: TTTTCACCCGAAAATCCAGA. Internal WT amplicon: 3317 bp. Deletion size: 2091 bp. Deletion left flank: ATTTGGGGGAAAATTAGATGAACTTTTGTT. Deletion right flank: AAAAAACTTAAATTTTCAGCAAAAATTGCT."

Proper citation: RRID:WB-STRAIN:WBStrain00036907 Copy   


  • RRID:WB-STRAIN:WBStrain00036906

http://www.wormbase.org/db/get?name=WBStrain00036906

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003056(lon-2)|WBGene00012261(lpr-3)
Genomic Alteration: WBGene00003056(lon-2), WBGene00012261(lpr-3)
Availability: available
References:
Synonyms: +/szT1 [lon-2(e678)] I; lpr-3(ok2351)/szT1 X.
Alternate IDs: WB-STRAIN:VC1829, CGC_VC1829
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"W04G3.8. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2351 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACCTGACCGAATGGAAGTG. External right primer: TGCCTGTGTGTTCCATGTTT. Internal left primer: CAATGCGAATTTGTATTTCCG. Internal right primer: TGAGTAATTAGGGCACGGTGT. Internal WT amplicon: 3060 bp. Deletion size: 1878 bp. Deletion left flank: CAAAACCAGCTTATCAAATTCTTTGGACTT. Deletion right flank: ACAACGCATTGAACCCCACTTAAAAAGGGT. Insertion Sequence: C."

Proper citation: RRID:WB-STRAIN:WBStrain00036906 Copy   


  • RRID:WB-STRAIN:WBStrain00036981

http://www.wormbase.org/db/get?name=WBStrain00036981

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006765(unc-29)
Genomic Alteration: WBGene00006765(unc-29)
Availability: available
References:
Synonyms: unc-29(ok2450) I.
Alternate IDs: WB-STRAIN:VC1944, CGC_VC1944
Notes: T08G11.5. External left primer: GCGTTACAGAAGTCTGCCCT. External right primer: TGACGTCTCCAGTCCCTCTT. Internal left primer: TGTTATTTGATTCACCCGCA. Internal right primer: TTGACGGGCGGTTAATATGT. Internal WT amplicon: 3194 bp. Deletion size: 1480 bp. Deletion left flank: CGATGAGTTCTTGGTCCTCGGAAATATACA. Deletion right flank: AACATTTGTATGCATAACTTGATCTTTCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036981 Copy   


  • RRID:WB-STRAIN:WBStrain00036980

http://www.wormbase.org/db/get?name=WBStrain00036980

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00009551(mob-1)
Genomic Alteration: WBGene00009551(mob-1)
Availability: available
References:
Synonyms: F38H4.10(ok2146) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1942, CGC_VC1942
Notes: F38H4.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2146 homozygotes (grotty, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTCACCACTTCCCGTCTTC. External right primer: CGCATTTTCAGAATTTGGTG. Internal left primer: CAAAATGCGAATGGACAACA. Internal right primer: GGGAATCACAGAATTGGGAA. Internal WT amplicon: 2120 bp. Deletion size: 934 bp. Deletion left flank: ATTCTTTGAATGACTACTGTAGCGCCTGTG. Deletion right flank: GAAGAAACTGAACCATTACGGGAAATCATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036980 Copy   


  • RRID:WB-STRAIN:WBStrain00036982

http://www.wormbase.org/db/get?name=WBStrain00036982

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010373(H08M01.1)
Genomic Alteration: WBGene00010373(H08M01.1)
Availability: available
References:
Synonyms: H08M01.1(ok2518) IV.
Alternate IDs: WB-STRAIN:VC1945, CGC_VC1945
Notes: H08M01.1. External left primer: GCCTAGGATTCAGGTGGGAT. External right primer: TCATTGTGTGAACGAACGGT. Internal left primer: TGTTTCATGGGTTGGGAAAT. Internal right primer: TGATTGGGCATTCGAAAAAT. Internal WT amplicon: 3201 bp. Deletion size: 1630 bp. Deletion left flank: AAACTTTTTCGCAGCAATGACTTTTGGGGC. Deletion right flank: TCTGTGTTGGTGGATTTGGTCGCGCATCAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036982 Copy   


  • RRID:WB-STRAIN:WBStrain00036986

http://www.wormbase.org/db/get?name=WBStrain00036986

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010491(K02B7.3)
Genomic Alteration: WBGene00010491(K02B7.3)
Availability: available
References:
Synonyms: K02B7.3(ok2382) II.
Alternate IDs: WB-STRAIN:VC1950, CGC_VC1950
Notes: K02B7.3. External left primer: GCTAATCAGCGGAAAAGCAC. External right primer: TTAATGCCAACAAACCGTGA. Internal left primer: GATTTTCTATCGCTCTGCCG. Internal right primer: GAAATTTCCAGAAATGCCCA. Internal WT amplicon: 2157 bp. Deletion size: 1347 bp. Deletion left flank: GCGACTGTTTTCCAAAGTGCTCCTCTGTCG. Deletion right flank: TTTTGTGGAGAGTCTGAAAATTTTAAAATT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036986 Copy   


  • RRID:WB-STRAIN:WBStrain00036908

http://www.wormbase.org/db/get?name=WBStrain00036908

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00016258(vha-16)
Genomic Alteration: WBGene00000254(bli-4), WBGene00016258(vha-16)
Availability: available
References:
Synonyms: vha-16(ok2332) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1831, CGC_VC1831
Notes: C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036908 Copy   


  • RRID:WB-STRAIN:WBStrain00036956

http://www.wormbase.org/db/get?name=WBStrain00036956

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00006573(tin-10)|WBGene00013448(Y66D12A.24)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006573(tin-10), WBGene00013448(Y66D12A.24)
Availability: available
References:
Synonyms: Y66D12A.24&tin-10(ok2400) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1898, CGC_VC1898
Notes: Made_by: Anna Rankin|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y66D12A.22, Y66D12A.24. Homozygous lethal or sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2400 homozygotes (late larval arrest or sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGCTCACTTGACACTTTCG. External right primer: TGGGGAAAATCGAAAACTTG. Internal left primer: CTGTGCAATTTGTGATTGCC. Internal right primer: ATATGTACCGCCGAATGACC. Internal WT amplicon: 2686 bp. Deletion size: 1690 bp. Deletion left flank: TTCATTTTGGCTAATTTCTCAGTAAAAATT. Deletion right flank: TTCGATTTAAAAAAAATCGATTTTTTTCAC."

Proper citation: RRID:WB-STRAIN:WBStrain00036956 Copy   


  • RRID:WB-STRAIN:WBStrain00036958

http://www.wormbase.org/db/get?name=WBStrain00036958

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017580(lgc-4)
Genomic Alteration: WBGene00017580(lgc-4)
Availability: available
References:
Synonyms: lgc-4(ok2567) X.
Alternate IDs: WB-STRAIN:VC1902, CGC_VC1902
Notes: F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGA TAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCC ATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAG TGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAAT CATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA.|"F18G5.4. External left primer: TATTCCATGATGGCGTCGTA. External right primer: CATGGTTGAGTGCAATGGTC. Internal left primer: TCAGGATCTGATGAATCCCC. Internal right primer: GCAGCGCTATCCGAGAATAC. Internal WT amplicon: 2935 bp. Deletion size: 2383 bp. Deletion left flank: ACTTGTAAAAATATGAAACGTATTTCAAAA. Deletion right flank: GCTATTTTTTAATCAGTCGCCTTCATTACA. Insertion Sequence: GGTGGTACTGACCAGAATTGCAGATCTACCAACGAGGCTATACGAATTGCAGGATTTGATAACTTTGCTGATCAGCTCCAAGAATCCAATGGCGTTTTCGAAGCATGCCCAGAGGCCCATTCAGAACAAGGAAATGAGAGTGAAGATTTTAAAGATTTGATCAATAGTGAAACTGAGTGCAACATTGAAGACGTTGTTCTCCCGACAGTACACGTTTCTACGGATTCTGAAGAAATCATTTCGGGCGATGTGATTATGAATGGTTAGTAGATTGTTTAA."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036958 Copy   


  • RRID:WB-STRAIN:WBStrain00036959

http://www.wormbase.org/db/get?name=WBStrain00036959

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011327(hlh-34)
Genomic Alteration: WBGene00011327(hlh-34)
Availability: available
References:
Synonyms: hlh-34(gk1031) V.
Alternate IDs: WB-STRAIN:VC1904, CGC_VC1904
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T01D3.2. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 163 bp. Deletion left flank: TAAAAAACAGAAAAAAAATTAAAAATATAT. Deletion right flank: TTAAATCAAAAACTTAAAAGTTACCGAGTT. Insertion Sequence: TATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036959 Copy   


  • RRID:WB-STRAIN:WBStrain00036952

http://www.wormbase.org/db/get?name=WBStrain00036952

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003056(lon-2)|WBGene00003968(peb-1)
Genomic Alteration: WBGene00003056(lon-2), WBGene00003968(peb-1)
Availability: available
References:
Synonyms: +/szT1 [lon-2(e678)] I; peb-1(ok1941)/szT1 X.
Alternate IDs: WB-STRAIN:VC1894, CGC_VC1894
Notes: T14F9.4. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1941 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GCGTGAGCAGTATGCCACTA. External right primer: GCCTGGGTTCAACATAGCAT. Internal left primer: AATTTAGGGCTTCCTTCCCA. Internal right primer: GCTGAATGGTGGCTCAACTT. Internal WT amplicon: 1610 bp. Deletion size: 779 bp. Deletion left flank: CTAGCTTTTGAGAGTGTCTAAGGGAATTGT. Deletion right flank: AAACGAATGATGAAGTTTGAAGTTGATGTA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036952 Copy   


  • RRID:WB-STRAIN:WBStrain00036953

http://www.wormbase.org/db/get?name=WBStrain00036953

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000872(cyk-1)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000872(cyk-1), WBGene00001072(dpy-10)
Availability: available
References:
Synonyms: +/mT1 II; cyk-1(ok2300)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC1895, CGC_VC1895
Notes: F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036953 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X