Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
VC1608
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036731 Caenorhabditis elegans spr-1(gk734) V. D1014.8. External left primer: TTGTTGGACGAGGTACTCCC. External right primer: AGGCTTCATGCAGCTTGTTT. Internal left primer: GGACGATTCATCGCGTTATT. Internal right primer: TTCAGAACAGCATTTCCGGT. Internal WT amplicon: 1855 bp. Deletion size: 1317 bp. Deletion left flank: ATACTAAAAACATAAATTTGATTATTAAAA. Deletion right flank: AGGAAACATGTTTTTATTTTATTTTTAGAA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00005006(spr-1) WBGene00005006(spr-1) WB-STRAIN:WBStrain00036731 WormBase (WB) WB available WB-STRAIN:VC1608, CGC_VC1608 2026-08-01 10:19:59 0
VC1625
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036746 Caenorhabditis elegans dylt-2(gk762) X. D1009.5. External left primer: TGAAAAATTGCGAACACCAA. External right primer: AGTCTGATTCTGGCGCTGTT. Internal left primer: TTTATGGAGAGATGGCCGAG. Internal right primer: GTCATTTCCATTGCTCCGAT. Internal WT amplicon: 1735 bp. Deletion size: 1182 bp. Deletion left flank: GAATCCCACTCTCTTCAGTTCTTTTTAATT. Deletion right flank: TTTCAAGAAATAGAGGAATCACAATAATTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00017014(dylt-2) WBGene00017014(dylt-2) WB-STRAIN:WBStrain00036746 WormBase (WB) WB available PMID:38302462 WB-STRAIN:VC1625, CGC_VC1625 2026-08-01 10:20:00 0
VC1628
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036748 Caenorhabditis elegans nhr-283(gk764) V. F57A10.6. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1323 bp. Deletion left flank: TTCTGATATCCCAGGAAGGCCTGAAAAATT. Deletion right flank: GTTAATTTTTTTAAAATCCCAGCTCAAAAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00010186(nhr-283) WBGene00010186(nhr-283) WB-STRAIN:WBStrain00036748 WormBase (WB) WB available WB-STRAIN:VC1628, CGC_VC1628 2026-08-01 10:19:54 0
VC1619
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036740 Caenorhabditis elegans +/szT1 [lon-2(e678)] I; sex-1(ok2071)/szT1 X. F44A6.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2071 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGGACTGGACCTACAGAGGG. External right primer: GGCAGCAACATCTACAGCAA. Internal left primer: TGTGTTGGAATGAAAACGGA. Internal right primer: AGGGACCAGATCAGTTGTGC. Internal WT amplicon: 3077 bp. Deletion size: 2408 bp. Deletion left flank: TACTAAGTCGATTCAATTCATGAATACATT. Deletion right flank: CACAGTCTTTTTACCACGCCTACATCGCAC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003056(lon-2)|WBGene00004786(sex-1) WBGene00003056(lon-2), WBGene00004786(sex-1) WB-STRAIN:WBStrain00036740 WormBase (WB) WB available WB-STRAIN:VC1619, CGC_VC1619 2026-08-01 10:20:00 0
VC1622
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036743 Caenorhabditis elegans let-765(ok2058) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). F20H11.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2058 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAATCGTATTGCTGCTTCCA. External right primer: CGGAGCTGGTGTAGGAAAAG. Internal left primer: GTCCATTCGAATCTTTCCGA. Internal right primer: TGCTGAACGTGATCTTCGAG. Internal WT amplicon: 3229 bp. Deletion size: 1540 bp. Deletion left flank: CACAGATTCTAGATGAAGTGATAAAATCCG. Deletion right flank: TTTTGAAGTTCTAAGACCATTCGTCCAGTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00002889(let-765) WBGene00000254(bli-4), WBGene00002889(let-765) WB-STRAIN:WBStrain00036743 WormBase (WB) WB available WB-STRAIN:VC1622, CGC_VC1622 2026-08-01 10:20:00 0
VC1621
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036742 Caenorhabditis elegans T26G10.1(ok2057) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). T26G10.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2057 homozygotes (arrest stage/phenotype undetermined). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCACCATCAGCAATATCCA. External right primer: TCCGTTGGACTTTCCAATTC. Internal left primer: TTTTGTCGTCGCTTCTTTCC. Internal right primer: AAGTGTCGTCAGATTGCGTG. Internal WT amplicon: 2101 bp. Deletion size: 1183 bp. Deletion left flank: AGTCGGAAAATTCAAAATCTAACCTAAATT. Deletion right flank: CTCTGAAGACAATTAACCAGTTATTTCAGT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00000254(bli-4)|WBGene00012059(T26G10.1) WBGene00000254(bli-4), WBGene00012059(T26G10.1) WB-STRAIN:WBStrain00036742 WormBase (WB) WB available WB-STRAIN:VC1621, CGC_VC1621 2026-08-01 10:19:54 0
VC1624
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036745 Caenorhabditis elegans F54H12.5&F54H12.6(ok2133) III. F54H12.6, F54H12.5. Superficially wild type. External left primer: TTGGATGGTCTTCTTCTGGG. External right primer: CGAAAATGAATGGGAGGAGA. Internal left primer: TGGAGTGGAAATTTCTTCCG. Internal right primer: CATGGGGTTTCGACAGACTT. Internal WT amplicon: 2179 bp. Deletion size: 1993 bp. Deletion left flank: AACCACGGTAACGGTCTCGACACGACAAGT. Deletion right flank: CTTTTCAGGAGTGAAACACGAAGGAATGAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00018845(F54H12.5)|WBGene00018846(eef-1B.1) WBGene00018845(F54H12.5), WBGene00018846(eef-1B.1) WB-STRAIN:WBStrain00036745 WormBase (WB) WB available WB-STRAIN:VC1624, CGC_VC1624 2026-08-01 10:19:54 0
VC1587
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036713 Caenorhabditis elegans C16C2.4&ocrl-1(gk752) I. C16C2.4, C16C2.3. External left primer: TGTTAGCTGCTGAATCACGG. External right primer: TGCACTTGAATCTGGACAGC. Internal left primer: GAAGTCCTTGCCACGGTAAA. Internal right primer: CCTACAATTCCGAGTGCCAT. Internal WT amplicon: 1898 bp. Deletion size: 1465 bp. Deletion left flank: TCTTTCCAGCGTCCTTCGCATATTCAAAAA. Deletion right flank: AAATAAAGAAAATATTAAACAAAATCGTTG. Insertion Sequence: AA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00007620(ocrl-1)|WBGene00007621(C16C2.4) WBGene00007620(ocrl-1), WBGene00007621(C16C2.4) WB-STRAIN:WBStrain00036713 WormBase (WB) WB available WB-STRAIN:VC1587, CGC_VC1587 2026-08-01 10:19:59 0
VC1592
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036716 Caenorhabditis elegans nhr-15(gk744) V. F33E11.1. External left primer: GGACACACGTTCATAATGCG. External right primer: ACTTGACGGGAATGTTTTCG. Internal left primer: GGGCTCCACATCTTTGCTTA. Internal right primer: ATGTTATGAAGGTGGCCGAG. Internal WT amplicon: 2369 bp. Deletion size: 2143 bp. Deletion left flank: CGTTTGTCCCGTTGTCCCGTTTTTTGAGTG. Deletion right flank: GTGAAATTTGATGCAGATAAAATTTTGTAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003614(nhr-15) WBGene00003614(nhr-15) WB-STRAIN:WBStrain00036716 WormBase (WB) WB available WB-STRAIN:VC1592, CGC_VC1592 2026-08-01 10:19:59 0
VC1594
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00036718 Caenorhabditis elegans mec-8(ok2043) I. F46A9.6. Superficially wild type. External left primer: ATAGCAAGTGTGTGAGGGGG. External right primer: CCGACACAACATTCGACATC. Internal left primer: CCTCGATCGTTGGCTGTTAT. Internal right primer: ATTTCTTTGTCGCCCCTTTT. Internal WT amplicon: 2265 bp. Deletion size: 1117 bp. Deletion left flank: TCGTTGGCTGTTATCTGGAATCCTTGTAGT. Deletion right flank: TGTTGCTCATTGAAAAGAGCTGCTGATTGA.|"Mutagen:UV/TMP"|"Supplementary_genotype mec-8 (ok2043) I"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003172(mec-8) WBGene00003172(mec-8) WB-STRAIN:WBStrain00036718 WormBase (WB) WB available PMID:37603562 WB-STRAIN:VC1594, CGC_VC1594 2026-08-01 10:19:53 1
VC1593
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036717 Caenorhabditis elegans nhr-229(gk743) IV. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAA TAAAAAATTTGAATGA."|"Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAATAAAAAATTTGAATGA." WBGene00013795(nhr-229) WBGene00013795(nhr-229) WB-STRAIN:WBStrain00036717 WormBase (WB) WB available WB-STRAIN:VC1593, CGC_VC1593 2026-08-01 10:19:54 0
VC1691
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036794 Caenorhabditis elegans sea-1(gk799) II. F19B10.9. External left primer: ACCGTCACGAATGAGGTTTC. External right primer: CTCTTGCCGACTTCGTTTTC. Internal left primer: TGCCTGAGCAATTTCCTTCT. Internal right primer: TTATATTTGCGGTGCTGTGC. Internal WT amplicon: 2319 bp. Deletion size: 668 bp. Deletion left flank: AGGAAGAGGACGGCCGGGAGGTGGATTGCA. Deletion right flank: ACGCTAAAATTGTCTGGAAAACTGCCAACG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00004750(sea-1) WBGene00004750(sea-1) WB-STRAIN:WBStrain00036794 WormBase (WB) WB available WB-STRAIN:VC1691, CGC_VC1691 2026-08-01 10:20:01 0
VC1692
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036795 Caenorhabditis elegans nhr-32(gk810) X. K08H2.8. External left primer: AACGAGGCATGTTGGTTTTC. External right primer: CACGAGTGATGCGAGAGTGT. Internal left primer: TTGTTAGGGTGATTGGGAGC. Internal right primer: CGGGTGTTGCTATATTGGGT. Internal WT amplicon: 2237 bp. Deletion size: 697 bp. Deletion left flank: GCGACGCGGCGGACGGGTTTCATTACGGTG. Deletion right flank: AGAATGATAACTCGACCATAAAACGTTTTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"Supplementary_genotype nhr-32(gk810)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00003626(nhr-32) WBGene00003626(nhr-32) WB-STRAIN:WBStrain00036795 WormBase (WB) WB available PMID:37906605 WB-STRAIN:VC1692, CGC_VC1692 2026-08-01 10:19:55 0
VC1695
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036798 Caenorhabditis elegans gpla-1(ok2127) V. F58H1.4. External left primer: TCGCCATAATCATGCAAAAA. External right primer: TTGCACTATTCCAGTGCTCG. Internal left primer: GATGCCCGTATCAACGAGAT. Internal right primer: ATGTGCCAAAGCATAACACG. Internal WT amplicon: 2318 bp. Deletion size: 979 bp. Deletion left flank: AAATTTAAAGGACACTGATCGAAGTTTAGT. Deletion right flank: CAACTTTCCCTCATGGTACTTGTTCGCTAT. Insertion Sequence: TTCCCTCAGGGTACTTGTT. gpla-1 formerly known as flr-2.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001466(gpla-1) WBGene00001466(gpla-1) WB-STRAIN:WBStrain00036798 WormBase (WB) WB available WB-STRAIN:VC1695, CGC_VC1695 2026-08-01 10:19:55 0
VC1586
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036712 Caenorhabditis elegans nhr-225(gk736) V. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T27B7.2. External left primer: CTTCAAACATTTCCGGGTGT. External right primer: TCAATTATCCGGCAAACTCC. Internal left primer: GGTCGTGTTTCCCAAATTGA. Internal right primer: CCTGCTTGGAAGCCATAGAC. Internal WT amplicon: 2309 bp. Deletion size: 904 bp. Deletion left flank: AGGATAATCACTCATCCAACTAAAATCGAA. Deletion right flank: ACAGAAGCACCTAGAAAAAGGTTTTGTTTA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00020849(nhr-225) WBGene00020849(nhr-225) WB-STRAIN:WBStrain00036712 WormBase (WB) WB available WB-STRAIN:VC1586, CGC_VC1586 2026-08-01 10:19:53 0
VC1602
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036725 Caenorhabditis elegans K06A1(gk750) II. K06A1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 552 bp. Deletion left flank: TTCTCCAATTTCCTGCCTATTTTGGCATAT. Deletion right flank: ATCAGAAATTTTACAATTTTCTTAATTTTT. Insertion Sequence: TT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WB-STRAIN:WBStrain00036725 WormBase (WB) WB available WB-STRAIN:VC1602, CGC_VC1602 2026-08-01 10:19:59 0
VC1601
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036724 Caenorhabditis elegans Y38H8A.4&Y38H8A.3(gk749) IV. Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1372 bp. Deletion left flank: CGTGGTATACCGTATACGTATACGGTAGAT. Deletion right flank: TTAATTTGAATTTTGTCAGCATTTTTGAGT." WBGene00012637(ttbk-8.1)|WBGene00012638(Y38H8A.4) WBGene00012637(ttbk-8.1), WBGene00012638(Y38H8A.4) WB-STRAIN:WBStrain00036724 WormBase (WB) WB available WB-STRAIN:VC1601, CGC_VC1601 2026-08-01 10:19:54 0
VC1604
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036727 Caenorhabditis elegans F34D6.2(gk1024) II. F34D6.2. External left primer: TCCTGTCAACCCTCAGCTCT. External right primer: ATAATGCATTGCAGAGCACG. Internal left primer: ATGGTTCACACGGTTTCTGG. Internal right primer: ACACAACGAGAGCCCATTTC. Internal WT amplicon: 2355 bp. Deletion size: 1207 bp. Deletion left flank: TGTTTTTCACAACTCTACAAACTATGCCTA. Deletion right flank: ATTGTCTTGTTTTCTCTCCGGCCTGCTTTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00018022(ceh-87) WBGene00018022(ceh-87) WB-STRAIN:WBStrain00036727 WormBase (WB) WB available WB-STRAIN:VC1604, CGC_VC1604 2026-08-01 10:19:54 0
VC1606
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036729 Caenorhabditis elegans elt-6(gk754) IV. F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 965 bp. Deletion left flank: TTTCACTTGAATCATCATTTTTGCATTTTC. Deletion right flank: AGGAGCTGGTGGAACTTTAGAAATAAGCCA. Insertion Sequence: GAGCT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00001253(elt-6) WBGene00001253(elt-6) WB-STRAIN:WBStrain00036729 WormBase (WB) WB available WB-STRAIN:VC1606, CGC_VC1606 2026-08-01 10:19:54 0
VC1605
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00036728 Caenorhabditis elegans tab-1(gk753) II. F31E8.3. External left primer: GCACAAGTTGTTGGGGAAGT. External right primer: TTCTTGTGCTTCATTCGTCG. Internal left primer: ATGAGAGGTCGAATTGTGCC. Internal right primer: CAAATTGAGAGCATTTGCCA. Internal WT amplicon: 1727 bp. Deletion size: 820 bp. Deletion left flank: ACTGAACATTACGAGACAATCAATTTCCAT. Deletion right flank: TGCAGCAGCAGCGTTTCCAATAGAACATAG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." WBGene00006380(tab-1) WBGene00006380(tab-1) WB-STRAIN:WBStrain00036728 WormBase (WB) WB available PMID:37587694 WB-STRAIN:VC1605, CGC_VC1605 2026-08-01 10:19:59 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.