Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00036672
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006916(vha-7)
Genomic Alteration: WBGene00006916(vha-7)
Availability: available
References:
Synonyms: vha-7(ok2015) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1535, CGC_VC1535
Notes: C26H9A.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2015 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1865 bp. Deletion left flank: AATTTCTCGATTTGAACAACAATGATTATG. Deletion right flank: AAGTTCGAATTTTTAGTCAGAATTTGGCGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036672 Copy
http://www.wormbase.org/db/get?name=WBStrain00036674
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00002169(isw-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00002169(isw-1)
Availability: available
References:
Synonyms: isw-1(ok1951) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1537, CGC_VC1537
Notes: F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036674 Copy
http://www.wormbase.org/db/get?name=WBStrain00036676
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001993(hpd-1)
Genomic Alteration: WBGene00001993(hpd-1)
Availability: available
References:
Synonyms: hpd-1(ok1955) III.
Alternate IDs: WB-STRAIN:VC1539, CGC_VC1539
Notes: T21C12.2. Superficially wild type. External left primer: TTGTGGCTGTGCACATTTTT. External right primer: AACATCCCCGTAGCCATTCT. Internal left primer: CGGCAATTTGTCAAAAATCA. Internal right primer: AAAACAGGAAACCGTTGTGG. Internal WT amplicon: 2256 bp. Deletion size: 1363 bp. Deletion left flank: TAATTCAGAACTCGGAAATCACCTTGTTCA. Deletion right flank: GCCCGTGGCTGTGAATTCCTTTCCATTCCA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036676 Copy
http://www.wormbase.org/db/get?name=WBStrain00036681
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003724(nhr-134)
Genomic Alteration: WBGene00003724(nhr-134)
Availability: available
References:
Synonyms: nhr-134(gk722) V.
Alternate IDs: WB-STRAIN:VC1546, CGC_VC1546
Notes: F44C8.2. External left primer: AAATGCCGAATTACTCGTCG. External right primer: TCAAAAACGCAGCAGACATC. Internal left primer: GCAGATTTGAGATTGCGGAT. Internal right primer: CAGAAGCGATTCTTCTTGCC. Internal WT amplicon: 1783 bp. Deletion size: 915 bp. Deletion left flank: CCAAAAAACTTCGGGACGCCATTTTGGAGT. Deletion right flank: AAAAGAGTTAGTCAAATTTCTTGAAGCTTC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036681 Copy
http://www.wormbase.org/db/get?name=WBStrain00036606
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011932(sptl-3)
Genomic Alteration: WBGene00011932(sptl-3)
Availability: available
References:
Synonyms: sptl-3(gk662) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC1451, CGC_VC1451
Notes: Mutagen:UV/TMP|"T22G5.5. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk662 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGTTCTCCGTCTCGTCATTG. External right primer: ATTGAGTTCGTGGCAAATCC. Internal left primer: CTTGGTGTCCCTTTCGTGTT. Internal right primer: GTGTGCAACGTGGTTACCTG. Internal WT amplicon: 1706 bp. Deletion size: 1080 bp. Deletion left flank: TGGGTGTCTTCTCTCTAAATACAATTGATT. Deletion right flank: ATCTCGGCTTCTCGCATCGATCTGGAGTAT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036606 Copy
http://www.wormbase.org/db/get?name=WBStrain00036607
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003114(mab-23)
Genomic Alteration: WBGene00003114(mab-23)
Availability: available
References:
Synonyms: mab-23(gk664) V.
Alternate IDs: WB-STRAIN:VC1452, CGC_VC1452
Notes: C32C4.5. Superficially wild type. External left primer: GAACATTTGGTTGCAGCAGA. External right primer: AAGCACGGAGACGAGAAAAA. Internal left primer: CGCCTGACATCCGATCTATT. Internal right primer: TGCCATTGATGTTGCAGTTT. Internal WT amplicon: 2340 bp. Deletion size: 586 bp. Deletion left flank: AAGAAGGGACACAAACAGAAATGTCCATAC. Deletion right flank: TCGGCATCTTTTTTCATACATGAACAGAAT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036607 Copy
http://www.wormbase.org/db/get?name=WBStrain00036684
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00020112(pfd-5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020112(pfd-5)
Availability: available
References:
Synonyms: pfd-5(gk706) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1549, CGC_VC1549
Notes: Mutagen:UV/TMP|"R151.9. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk706 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGGAACTGGTGCTTTTTCG. External right primer: ACATTGCAGGGAAACAAAGG. Internal left primer: ATAGCAGCGAGACAAGCACA. Internal right primer: TTGAATTACCGCCAACAGTG. Internal WT amplicon: 1648 bp. Deletion size: 587 bp. Deletion left flank: TCGCAGTTTGTCACCGGTTGAACTCTCATT. Deletion right flank: CCTGCAGTTGCAATTTTCACATCGTCCAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036684 Copy
http://www.wormbase.org/db/get?name=WBStrain00036683
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012063(fbxb-1)
Genomic Alteration: WBGene00012063(fbxb-1)
Availability: available
References:
Synonyms: fbxb-1(ok2052) V.
Alternate IDs: WB-STRAIN:VC1548, CGC_VC1548
Notes: Made_by: Vancouver KO Group|"T26H2.1. Superficially wild type. External left primer: AACCGGAAGGTTCTCCAAGT. External right primer: TGTACAAGAAGACGACCCCC. Internal left primer: TCTTCCCGATTGATGACTCC. Internal right primer: AAACTTCCGGCAAATTGATG. Internal WT amplicon: 2121 bp. Deletion size: 1037 bp. Deletion left flank: TTTAAACGTTTTTTTTTAACTTCTCTCTTT. Deletion right flank: GGAATGAGGTGGATTTTGAGAACAATCCAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036683 Copy
http://www.wormbase.org/db/get?name=WBStrain00036690
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017423(F13C5.2)
Genomic Alteration: WBGene00017423(F13C5.2)
Availability: available
References:
Synonyms: F13C5.2(gk716) X.
Alternate IDs: WB-STRAIN:VC1555, CGC_VC1555
Notes: F13C5.2. External left primer: GCAAAATCTTTGTTGGGGAA. External right primer: TCGCCGATCAACTTCTTTCT. Internal left primer: CATTCTGCCATTTCCTTCGT. Internal right primer: CGTCAACTGGCTTACGGAAT. Internal WT amplicon: 1651 bp. Deletion size: 385 bp. Deletion left flank: CTCTGTTCTCTCAGCGGTGGCCAGTGTGTA. Deletion right flank: ATTACTCAGAACTATAAAAACAACATTACA.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036690 Copy
http://www.wormbase.org/db/get?name=WBStrain00036779
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010120(dot-1.4)
Genomic Alteration: WBGene00010120(dot-1.4)
Availability: available
References:
Synonyms: F55G7.2(ok2176) X.
Alternate IDs: WB-STRAIN:VC1667, CGC_VC1667
Notes: . External left primer: TTTGCACAGTTCGAGGTGAC. External right primer: CCCCGGATGTTCTACTTTGA. Internal left primer: TCACTGCCAGCCAATTAAAA. Internal right primer: CGTTTGAAAGAAAGGGACCA. Internal WT amplicon: 2188 bp. Deletion size: 1425 bp. Deletion left flank: GTTTTGTTTCAACAAGCGATTCTGAGATTA. Deletion right flank: TAACGCAACTGCTTCATTAAATTTTGCAAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036779 Copy
http://www.wormbase.org/db/get?name=WBStrain00036772
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006697(uaf-1)
Genomic Alteration: WBGene00006697(uaf-1)
Availability: available
References:
Synonyms: uaf-1(gk800) III.
Alternate IDs: WB-STRAIN:VC1657, CGC_VC1657
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y92C3B.2. External left primer: ACCGGTTACTGTAGGCATCG. External right primer: TCGGTGATTTTGGTGTGAAA. Internal left primer: AGCGTTATTTGCTGCGATTT. Internal right primer: TCACAGGAGCACATTTGACC. Internal WT amplicon: 1809 bp. Deletion size: 737 bp. Deletion left flank: GTTTTGCCATGAAAAAGTGCAAATTTAGGT. Deletion right flank: TCAATTTTTCGCTCTAAAATCGAATTTCTG."
Proper citation: RRID:WB-STRAIN:WBStrain00036772 Copy
http://www.wormbase.org/db/get?name=WBStrain00036773
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00019994(cdh-1)
Genomic Alteration: WBGene00019994(cdh-1)
Availability: available
References:
Synonyms: cdh-1(gk784) III.
Alternate IDs: WB-STRAIN:VC1658, CGC_VC1658
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 579 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGT. Deletion right flank: TTGGGGGTAGATTTACTGAGGATATTGTAG. Insertion Sequence: T."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036773 Copy
http://www.wormbase.org/db/get?name=WBStrain00036775
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003095(lys-6)
Genomic Alteration: WBGene00003095(lys-6)
Availability: available
References:
Synonyms: lys-6(ok2075) IV.
Alternate IDs: WB-STRAIN:VC1662, CGC_VC1662
Notes: F58B3.3. External left primer: TTGTTTGATTGCACGTGGTT. External right primer: GATCGTGGTGTGGTTCACAG. Internal left primer: TTGGCTTCCAAACCATTTTC. Internal right primer: ATCAATGCCTCTGGATCGAC. Internal WT amplicon: 2135 bp. Deletion size: 1265 bp. Deletion left flank: GAGAACGCTTTCGTGAATCGGGATTTAAAA. Deletion right flank: TTTAGGCAAGGGAAGATGTATCCATCGACA. Insertion Sequence: GGCAAGGGAAGAAGAGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036775 Copy
http://www.wormbase.org/db/get?name=WBStrain00036777
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017795(F25F8.1)
Genomic Alteration: WBGene00017795(F25F8.1)
Availability: available
References:
Synonyms: F25F8.1(ok2170) I.
Alternate IDs: WB-STRAIN:VC1664, CGC_VC1664
Notes: F25F8.1. External left primer: GCGACTAATTGGCCATCTTT. External right primer: AAAAACGCAGAAGGTAGCGA. Internal left primer: AGAATCAAAGCATGCCGAGT. Internal right primer: GTGCTCAACGCCTTCTTCTC. Internal WT amplicon: 3183 bp. Deletion size: 1851 bp. Deletion left flank: ATGCACTTTTTGCAACTTTGTGCAATTAGG. Deletion right flank: TTTTTAATGTTTCAAAAGTGTAGATTATGT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036777 Copy
http://www.wormbase.org/db/get?name=WBStrain00036781
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00019424(aptf-1)
Genomic Alteration: WBGene00019424(aptf-1)
Availability: available
References:
Synonyms: aptf-1(gk794) II.
Alternate IDs: WB-STRAIN:VC1669, CGC_VC1669
Notes: K01A1.1. External left primer: CTGTGGGATTTGCAGGACTT. External right primer: CCGGATCGATTGCTAGAGAG. Internal left primer: ACAAACATTGACAGGAGCCC. Internal right primer: CCAATTTCTCGGGAATGAAA. Internal WT amplicon: 2095 bp. Deletion size: 655 bp. Deletion left flank: CAGTGAGCAATTCACAACAGTTCTTCAATG. Deletion right flank: ATTAACGCTCCATAACGCTCGTACTTGTCA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"Supplementary_genotype aptf-1(gk794) II"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036781 Copy
http://www.wormbase.org/db/get?name=WBStrain00036780
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001477(fmo-2)
Genomic Alteration: WBGene00001477(fmo-2)
Availability: available
References:
Synonyms: fmo-2(ok2147) IV.
Alternate IDs: WB-STRAIN:VC1668, CGC_VC1668
Notes: K08C7.5. External left primer: TGTTCAATGATCGTACCCGA. External right primer: GTTCGAAATTGGGAAATCCA. Internal left primer: CGTGATCAGAGACGACCAAA. Internal right primer: AATGGTCGTTTTACCGCATC. Internal WT amplicon: 2216 bp. Deletion size: 1070 bp. Deletion left flank: GAGAAGAAAAAACGTTGGAAGAAATCTTTG. Deletion right flank: AACGGTGCCAGAAATGCGATTTTGACTATT. Insertion Sequence: GA.|"Made_by: Vancouver KO Group"|"Supplementary_genotype [fmo-2(ok2147)]"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036780 Copy
http://www.wormbase.org/db/get?name=WBStrain00036703
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00018520(F46H5.4)
Genomic Alteration: WBGene00018520(F46H5.4)
Availability: available
References:
Synonyms: F46H5.4(gk701) X.
Alternate IDs: WB-STRAIN:VC1576, CGC_VC1576
Notes: F46H5.4. External left primer: GGACGAAGTGAACGAAGAGC. External right primer: AACAAGGTCAATGTTTCGGC. Internal left primer: GTCCGGTGCAAATTCAGATT. Internal right primer: GACAGCCGCACAGCTCTAGT. Internal WT amplicon: 2100 bp. Deletion size: 1294 bp. Deletion left flank: ATTATTATTATTATTATACGTAAACTCGGA. Deletion right flank: GAAGAGAAGGAAGAATAACGCAGCAGGCCA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036703 Copy
http://www.wormbase.org/db/get?name=WBStrain00036704
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012637(ttbk-8.1)|WBGene00012638(Y38H8A.4)
Genomic Alteration: WBGene00012637(ttbk-8.1), WBGene00012638(Y38H8A.4)
Availability: available
References:
Synonyms: Y38H8A.4&Y38H8A.3(gk727) IV.
Alternate IDs: WB-STRAIN:VC1578, CGC_VC1578
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1192 bp. Deletion left flank: TTGATCACCTTCGCCGCCACTTCAAGCTTC. Deletion right flank: TTGTACAGGCCTATTTCTCAGATTAAGCCT. Insertion Sequence: GAAA."
Proper citation: RRID:WB-STRAIN:WBStrain00036704 Copy
http://www.wormbase.org/db/get?name=WBStrain00036707
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00019364(mksr-1)
Genomic Alteration: WBGene00019364(mksr-1)
Availability: available
References:
Synonyms: mksr-1(gk739) X.
Alternate IDs: WB-STRAIN:VC1581, CGC_VC1581
Notes: K03E6.4. External left primer: GAAGGGCAAATCGATGAAAA. External right primer: GATTCAACGGGTGCTTCTGT. Internal left primer: ATTGGATTCTTCCGGGAACT. Internal right primer: CTAACAGGTTCGAGGCGAAG. Internal WT amplicon: 1986 bp. Deletion size: 1241 bp. Deletion left flank: AATCGACTTTTTGGAGTTTTTTGGCAAATA. Deletion right flank: TACATCAAAAAAAATACTGTGATAAAAATT. Insertion Sequence: A.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036707 Copy
http://www.wormbase.org/db/get?name=WBStrain00036709
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00019994(cdh-1)
Genomic Alteration: WBGene00019994(cdh-1)
Availability: available
References:
Synonyms: cdh-1(gk747) III.
Alternate IDs: WB-STRAIN:VC1583, CGC_VC1583
Notes: Mutagen:UV/TMP|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTG TGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC."|"R10F2.1. External left primer: GAGGTTCTCACCTGCTCTGG. External right primer: ACGAGCTGGATTCGCTTAAA. Internal left primer: GGCGAGGAATCCTAACATGA. Internal right primer: AAACGACAAGCAGTGGCTCT. Internal WT amplicon: 1931 bp. Deletion size: 1004 bp. Deletion left flank: AGAAGCCGAGAAATGAAATGAAATTTAGGTAGAAGGGCCCTGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG. Deletion right flank: AGAGTTTGGGCTTATTTTTTGAAATTTTCC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036709 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.