Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00036472

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00016097(C25E10.8)
Genomic Alteration: WBGene00016097(C25E10.8)
Availability: available
References:
Synonyms: C25E10.8(ok1753) V.
Alternate IDs: WB-STRAIN:VC1277, CGC_VC1277
Notes: C25E10.8. Superficially wild type. External left primer: GGAAGACAAAACGGGTCTCA. External right primer: AAAAGCAAAACATCGGTTGG. Internal left primer: TAACGGGCTTAAACAGACGC. Internal right primer: GGTTTCGTTCGTCATGGACT. Internal WT amplicon: 2279 bp. Deletion size: 1885 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036472 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036431

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002222(klp-11)
Genomic Alteration: WBGene00002222(klp-11)
Availability: available
References:
Synonyms: klp-11(tm324) IV.
Alternate IDs: WB-STRAIN:VC1228, CGC_VC1228
Notes: 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036431 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036433

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00008099(hzl-1)
Genomic Alteration: WBGene00008099(hzl-1)
Availability: available
References:
Synonyms: C44H9.4(ok1688) V.
Alternate IDs: WB-STRAIN:VC1230, CGC_VC1230
Notes: C44H9.4. Superficially wild type. External left primer: GAACAGAATGCGTTCAGCAA. External right primer: AAATCAAAAGACCGGTTTCG. Internal left primer: CTCCAAAACCCCGTCAAGTA. Internal right primer: TTCGGTGTCCTCTTTGGTTT. Internal WT amplicon: 3088 bp. Deletion size: 737 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036433 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036435

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
References:
Synonyms: ocr-2(ok1711) IV.
Alternate IDs: WB-STRAIN:VC1233, CGC_VC1233
Notes: T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036435 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036440

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004807(skr-1)
Genomic Alteration: WBGene00004807(skr-1)
Availability: available
References:
Synonyms: skr-1(ok1696) I.
Alternate IDs: WB-STRAIN:VC1241, CGC_VC1241
Notes: F46A9.5. Superficially wild type. External left primer: AATCCGTAAGGAAAACGCCT. External right primer: AGTGTTTTCGGAAATGGCAC. Internal left primer: CACTGCCAGCTGACACAACT. Internal right primer: CGCAGAATTTGAACACGTTG. Internal WT amplicon: 2194 bp. Deletion size: 1740 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036440 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036449

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00003803(rae-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003803(rae-1)
Availability: available
References:
Synonyms: rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1251, CGC_VC1251
Notes: F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036449 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036443

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00004873(smc-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00004873(smc-3)
Availability: available
References:
Synonyms: smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1245, CGC_VC1245
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."

Proper citation: RRID:WB-STRAIN:WBStrain00036443 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036446

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00013552(gmn-1)|WBGene00013553(Y75B8A.18)
Genomic Alteration: WBGene00000254(bli-4), WBGene00013552(gmn-1), WBGene00013553(Y75B8A.18)
Availability: available
References:
Synonyms: gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1248, CGC_VC1248
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00036446 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036448

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00021636(pcaf-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00021636(pcaf-1)
Availability: available
References:
Synonyms: pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1250, CGC_VC1250
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT."

Proper citation: RRID:WB-STRAIN:WBStrain00036448 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036447

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00006735(ula-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006735(ula-1)
Availability: available
References:
Synonyms: +/mT1 II; ula-1(ok1700)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC1249, CGC_VC1249
Notes: C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036447 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036451

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000787(cps-6)
Genomic Alteration: WBGene00000787(cps-6)
Availability: available
References:
Synonyms: cps-6(ok1718) I.
Alternate IDs: WB-STRAIN:VC1253, CGC_VC1253
Notes: C41D11.8. Superficially wild type. External left primer: TCGTGTTTTTGTTTCCTCCC. External right primer: TTGTTCTGATCGCAGTTGGA. Internal left primer: CCTTTTCCACCTTCCCCTAT. Internal right primer: AAGCTTCGGGTGATTTCTGA. Internal WT amplicon: 2220 bp. Deletion size: 676 bp. Deletion left flank: CCTTCCCCTATTTCGGATGAATTTTTGTTG. Deletion right flank: AGTTACGTGTTTTTGCGAAAAACTTCGTCG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036451 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036537

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: C17E7(gk600) V.
Alternate IDs: WB-STRAIN:VC1351, CGC_VC1351
Notes: C17E7. Superficially wild type. External left primer: TTGAGGACGGAGTTGCTCTT. External right primer: TCTCCACTGCTTGTTGATCG. Internal left primer: TCCAAATACCGTAGCCCATC. Internal right primer: TCCACCGTCTCTAAGCGAAT. Internal WT amplicon: 1642 bp. Deletion size: 608 bp. Deletion left flank: CGAGGACAACGTGAATATTGCAAAGAGCAA. Deletion right flank: TTTTGTGAGATAAATTGCCTCAACCCTGTA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036537 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036530

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00020383(tin-44)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020383(tin-44)
Availability: available
References:
Synonyms: T09B4.9(ok1792) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1344, CGC_VC1344
Notes: T09B4.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1792 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTTCAGGCATTATCCA. External right primer: TCAAAATTGCATCACTGGGA. Internal left primer: TCTTCGCTCCGAATTGAACT. Internal right primer: TTGTGGAAACGGGATACGAT. Internal WT amplicon: 2834 bp. Deletion size: 1635 bp. Deletion left flank: AAAAGTTGAGATTTAATTAGGACACTGAGA. Deletion right flank: TTCTCCAAATCGAACCCATCTGTCCGTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036530 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036532

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: available
References:
Synonyms: F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1346, CGC_VC1346
Notes: F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036532 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036534

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001037(dnj-19)
Genomic Alteration: WBGene00001037(dnj-19)
Availability: available
References:
Synonyms: dnj-19(gk649) V.
Alternate IDs: WB-STRAIN:VC1348, CGC_VC1348
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T05C3.5. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 931 bp. Deletion left flank: TAAGGAAATTATAGCCGCAAAGTGCCTCAT. Deletion right flank: CGGCCTGCGAAGCGTCTGGTCTCACATTGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036534 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036535

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003637(nhr-47)
Genomic Alteration: WBGene00003637(nhr-47)
Availability: available
References:
Synonyms: nhr-47(gk954) V.
Alternate IDs: WB-STRAIN:VC1349, CGC_VC1349
Notes: C24G6.4. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 742 bp. Deletion left flank: TTAATAATTCAATAATGTAAATTATTGAAT. Deletion right flank: GTAAGATCAATTTAACAAGCATCAAACATC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036535 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036549

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004466(rpn-10)
Genomic Alteration: WBGene00004466(rpn-10)
Availability: available
References:
Synonyms: rpn-10(ok1865) I.
Alternate IDs: WB-STRAIN:VC1369, CGC_VC1369
Notes: B0205.3. Superficially wild type. External left primer: CTTTTTAAGCGGTGCGTCAT. External right primer: GCTCGATATTCCATCCGAAA. Internal left primer: TGGGTCTCTTCTCGCATCTC. Internal right primer: TGCACCAACAACTCCACATT. Internal WT amplicon: 2184 bp. Deletion size: 1166 bp. Deletion left flank: CAGAATCCGCGGCACCTCCATTTGCAGCAG. Deletion right flank: TATGAACTCTGTAGAATGTGAGAAATAAAA.|"Mutagen:UV/TMP"|"Supplementary_genotype (rpn-10(ok1865) I)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036549 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036541

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00019154(glf-1)
Genomic Alteration: WBGene00019154(glf-1)
Availability: available
References:
Synonyms: H04M03.4(ok1750)/nT1 IV; +/nT1 V.
Alternate IDs: WB-STRAIN:VC1357, CGC_VC1357
Notes: H04M03.4. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1750 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGGAAATTGTGCCGTTAAT. External right primer: TTTTGCGAATTTTTCATCCC. Internal left primer: AATGTTTCAGGAGGCCATTG. Internal right primer: TATCCCCGTGGAATAGTTGG. Internal WT amplicon: 3042 bp. Deletion size: 1376 bp. Deletion left flank: AGAAGTTGCCAAATGAGTGGTTCAAGTTCA. Deletion right flank: TATATGTGCTATATAATTCTCATAATTTCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036541 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036540

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011566(nhr-214)
Genomic Alteration: WBGene00011566(nhr-214)
Availability: available
References:
Synonyms: nhr-214(gk604) X.
Alternate IDs: WB-STRAIN:VC1356, CGC_VC1356
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T07C5.3. Superficially wild type. External left primer: TTCGCATAGGATTGTTGCAG. External right primer: GGTTGGCTTCTGCAGTTTTC. Internal left primer: GTTTGTTCTCACTGGACGCA. Internal right primer: ATCACAACGACCGGCTATTC. Internal WT amplicon: 1847 bp. Deletion size: 337 bp. Deletion left flank: CGATTGAAACGAGACGTTGGAAAATTAGTA. Deletion right flank: TGCTCCTTTGAAAAAGTATTTCAAATCTTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036540 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00036543

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: available
References:
Synonyms: Y48G1C.7(ok1850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1360, CGC_VC1360
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G1C.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1850 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGGGTCGACTATCACATCA. External right primer: CTCGCAGAGCTCACAAAGTG. Internal left primer: CACAACCACTTGTTCGAGGA. Internal right primer: CGCGTGTAGGATCCATTTTT. Internal WT amplicon: 3378 bp. Deletion size: 985 bp. Deletion left flank: AATTAGATAAAAATTGGATTTTCAGCACAT. Deletion right flank: TTTTTTACTTTCGGAACGTCCCACTTTTGC."

Proper citation: RRID:WB-STRAIN:WBStrain00036543 Copy   

•   Source: Integrated Animals