Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
The record is no longer available at this source.
Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: (null) This is a legacy resource.
Proper citation: RRID:WB-STRAIN:ZZY0041 Copy
The record is no longer available at this source.
Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: (null) This is a legacy resource.
Proper citation: RRID:WB-STRAIN:TRG_1481 Copy
The record is no longer available at this source.
Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: (null) This is a legacy resource.
Proper citation: RRID:WB-STRAIN:TRG_1482 Copy
The record is no longer available at this source.
Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Alternate IDs:
Notes: (null) This is a legacy resource.
Proper citation: RRID:WB-STRAIN:WN046 Copy
http://www.wormbase.org/db/get?name=WBStrain00037345
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00018202(F39F10.2)|WBGene00020004(R11E3.2)|WBGene00021246(Y22D7AL.7)|WBGene00022773(ZK616.3)
Genomic Alteration: WBGene00018202(F39F10.2), WBGene00020004(R11E3.2), WBGene00021246(Y22D7AL.7), WBGene00022773(ZK616.3)
Availability: available
References:
Synonyms: Y22D7AL.7(gk3210) III; R11E3.2(gk3211) ZK616.3(gk3212) IV; F39F10.2(gk1161) X.
Alternate IDs: WB-STRAIN:VC2461, CGC_VC2461
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037345 Copy
http://www.wormbase.org/db/get?name=WBStrain00037352
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012792(Y43D4A.6)
Genomic Alteration: WBGene00012792(Y43D4A.6)
Availability: available
References:
Synonyms: Y43D4A.6(gk1142) IV.
Alternate IDs: WB-STRAIN:VC2476, CGC_VC2476
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC."
Proper citation: RRID:WB-STRAIN:WBStrain00037352 Copy
http://www.wormbase.org/db/get?name=WBStrain00037353
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011979(sysm-1)
Genomic Alteration: WBGene00011979(sysm-1)
Availability: available
References:
Synonyms: T24B8.5(ok3236) II.
Alternate IDs: WB-STRAIN:VC2477, CGC_VC2477
Notes: Made_by: Vancouver KO Group|"T24B8.5. External left primer: CCGTCTCTCTCCGTTTTGTT. External right primer: CTACATCCGGCTGCCTATTC. Internal left primer: CTTTTCCGTCCGTTCGATT. Internal right primer: CCCTTGAATGCTTCTGGTTT. Internal WT amplicon: 1299 bp. Deletion size: 509 bp. Deletion left flank: TTTGGGCATTGTCTGAAATTTCAGATGAGA. Deletion right flank: GGTAAAGTTTAGAACAATTGAAGTGACAAA. Insertion Sequence: CTATAAAAACTACGTCAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037353 Copy
http://www.wormbase.org/db/get?name=WBStrain00037350
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017510(nhr-178)
Genomic Alteration: WBGene00017510(nhr-178)
Availability: available
References:
Synonyms: nhr-178(gk1158) V.
Alternate IDs: WB-STRAIN:VC2474, CGC_VC2474
Notes: F16B4.9. Identified by PCR, validated by CGH. External left primer: ACATCCATCTTTCTGGCGAC. External right primer: TTCGGAGTCACAAGTTGCAG. Internal left primer: GCGCACCCTGAACATAGTTT. Internal right primer: AAATATGGGAGCAGCGTTTG. Internal WT amplicon: 1511 bp. Deletion size: 502 bp. Deletion left flank: ATCTAAAATCGCGCTTTTGATTTTGTTCTG. Deletion right flank: ATATAAACGACTATATTTGCATTGAATTCA. Insertion Sequence: TAAACGACTATATTTGCATTGA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037350 Copy
http://www.wormbase.org/db/get?name=WBStrain00037351
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010855(M04C7.4)|WBGene00017803(F26A1.4)
Genomic Alteration: WBGene00010855(M04C7.4), WBGene00017803(F26A1.4)
Availability: available
References:
Synonyms: M04C7.4(gk3034) I; F26A1.4(gk1160) III.
Alternate IDs: WB-STRAIN:VC2475, CGC_VC2475
Notes: F26A1.4, M04C7.4. The allele gk1160 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTTAGGTCTGGCACTACCCG. External right primer: AAAACATTGACACACCTGCG. Internal left primer: AAAGCGGCAGCAGTTAAGAA. Internal right primer: CTACCGGTACTGCCATTCGT. Internal WT amplicon: 1327 bp. Deletion size: 126 bp. Deletion left flank: TCACGGATCGGACTCTTTACCGTGCAATGG. Deletion right flank: TTTTTTAAATTGAAAATGCGAGCATCTAGG. The allele gk3034 was identified by CGH but not confirmed by PCR. Left flanking probe: GTACGGTAAGTTGGCCGAGTTGCATTATTCGTCTCGTTCAAGAGGATAAC. Right flanking probe: CAGGCACGCAGGCGCATCTGCACGTACCATGGCTACTTTAGCTGATGAAC. Left deleted probe: GATTTTATCAGCATACGGGCTCGTAAAAGAGAAGAGGAGACGAGGTTACG. Right deleted probe: CTGTGGCTGCTGTTCCAAATGCCAATCTGGAAATGGGAATTTCGGTAACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037351 Copy
http://www.wormbase.org/db/get?name=WBStrain00037354
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00017300(rpc-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00017300(rpc-2)
Availability: available
References:
Synonyms: +/mT1 II; F09F7.3(ok3162)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2479, CGC_VC2479
Notes: F09F7.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3162 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATACCCAACAGCAGGCACTC. External right primer: TTCGACAATTCCGTCATCAA. Internal left primer: TGTTACCTCAAAAGTCAAGGCT. Internal right primer: CGATTGGTTAGAGAACGGGA. Internal WT amplicon: 1204 bp. Deletion size: 794 bp. Deletion left flank: ACGTTTGGAGCTCGCTGGATCATTGCTTTC. Deletion right flank: TGGTGAAAGCCGTCAGAGATTTGAGAAGGT. Insertion Sequence: AT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037354 Copy
http://www.wormbase.org/db/get?name=WBStrain00037359
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001554(gcy-34)
Genomic Alteration: WBGene00001554(gcy-34)
Availability: available
References:
Synonyms: gcy-34(ok2953) V.
Alternate IDs: WB-STRAIN:VC2486, CGC_VC2486
Notes: M04G12.3. External left primer: GATTCTGATTTGCTTTCGGG. External right primer: ATCGACCTCAAATTCCGTTG. Internal left primer: CCGCACCTCTTTCATGATCT. Internal right primer: CATTTGCAATTTTATCAATGCTG. Internal WT amplicon: 1184 bp. Deletion size: 668 bp. Deletion left flank: ACTTTGTAAACACCACGAAGAACCACAATT. Deletion right flank: TTTTCACTTGAAGTACAAAAACAGCATTGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037359 Copy
http://www.wormbase.org/db/get?name=WBStrain00037363
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00016670(ilys-3)
Genomic Alteration: WBGene00016670(ilys-3)
Availability: available
References:
Synonyms: ilys-3(ok3222) IV.
Alternate IDs: WB-STRAIN:VC2496, CGC_VC2496
Notes: C45G7.3. External left primer: ATGCCAAAATCAAATGCACA. External right primer: CCACCTAAACACTTCCGTCC. Internal left primer: CTCCACTTCCTGTTTGCCAT. Internal right primer: TATGGGGTTTCCTGCAGATT. Internal WT amplicon: 1156 bp. Deletion size: 855 bp. Deletion left flank: TGAACTGTATCTTTGGTAGAATGGGTAGTA. Deletion right flank: CAGGGAGCATGCGAAGTGATGGCTCGTAAC.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037363 Copy
http://www.wormbase.org/db/get?name=WBStrain00037329
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002040(hum-7)
Genomic Alteration: WBGene00002040(hum-7)
Availability: available
References:
Synonyms: hum-7(ok3054) I.
Alternate IDs: WB-STRAIN:VC2436, CGC_VC2436
Notes: F56A6.2. External left primer: CCTAAGAAACAGTGGCCGAG. External right primer: TTGACGAGGTTGATGAGCAC. Internal left primer: TTGACGTCACTTCTCTTCCAGA. Internal right primer: CAGGACCTCTCTTGCTAGGC. Internal WT amplicon: 1199 bp. Deletion size: 653 bp. Deletion left flank: CGAACTTTGTAAGATTCACAGCATGAACCT. Deletion right flank: ATAATTTCTACTTATATTCAGTCATATAAA. Insertion Sequence: AATAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037329 Copy
http://www.wormbase.org/db/get?name=WBStrain00037324
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00007007(mak-2)
Genomic Alteration: WBGene00007007(mak-2)
Availability: available
References:
Synonyms: mak-2(gk1110) IV.
Alternate IDs: WB-STRAIN:VC2426, CGC_VC2426
Notes: C44C8.6. The gk1110 deletion allele in this strain was identified and isolated using PCR, and its breakpoints were determined by capillary sequencing of PCR products. Its presence was confirmed by the Vancouver Gene Knockout Lab by CGH (comparative genome hybridization). External left primer: ACTCTGTGCCACCAAAAACC. External right primer: CATATCCGTCCATTGTTCCC. Internal left primer: TGTCCTGCTTCAGTTTCCCT. Internal right primer: CATTGGTTGTCCGTGTTGAG. Internal WT amplicon: 1976 bp. Deletion size: 1024 bp. Deletion left flank: GAATTTTTAAATCAAAACTATTTGTTCCAA. Deletion right flank: GCGTATGACTAAGTCTATGCCTAAGCCTAA. Insertion Sequence: T.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037324 Copy
http://www.wormbase.org/db/get?name=WBStrain00037327
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004811(skr-5)
Genomic Alteration: WBGene00004811(skr-5)
Availability: available
References:
Synonyms: skr-5(ok3068) V.
Alternate IDs: WB-STRAIN:VC2434, CGC_VC2434
Notes: F47H4.10. External left primer: ATTTGTTGGGCGGTTATGAA. External right primer: CCGTCTCCACATCCATCTCT. Internal left primer: TTGATTTAAGATGGTTGTGGAAGA. Internal right primer: GCCTCCACCAACTGAAGAAG. Internal WT amplicon: 1342 bp. Deletion size: 813 bp. Deletion left flank: CTTCTGATGATGTAGAGTTCATTGTAGGTT. Deletion right flank: GAATAGGGAGTTAAAATAGGAAATAAAATA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037327 Copy
http://www.wormbase.org/db/get?name=WBStrain00037328
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010873(trpa-2)
Genomic Alteration: WBGene00010873(trpa-2)
Availability: available
References:
Synonyms: M05B5.6(ok3189) I.
Alternate IDs: WB-STRAIN:VC2435, CGC_VC2435
Notes: M05B5.6. External left primer: CAAAGGCGATGTCATTTGTG. External right primer: CTCGTCCAACTCACACCAGA. Internal left primer: AAAGCTGAACCAGGATTTTATGA. Internal right primer: TCCGGGAAATAAAGAGAAGGA. Internal WT amplicon: 1127 bp. Deletion size: 478 bp. Deletion left flank: GGCCATTTCAGATGAGGTAATATTTTACTT. Deletion right flank: GGATATTTGGACATTTGAGTTCCCCAAAAT.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037328 Copy
http://www.wormbase.org/db/get?name=WBStrain00037325
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00008205(sams-1)
Genomic Alteration: WBGene00008205(sams-1)
Availability: available
References:
Synonyms: sams-1(ok2946) X.
Alternate IDs: WB-STRAIN:VC2428, CGC_VC2428
Notes: C49F5.1. External left primer: AGGACTTGCGAGAGTACGGA. External right primer: CTTGAGAGCTTTTGGCTGCT. Internal left primer: AGTGAATCTGTGTCCGAGGG. Internal right primer: GGGAACTCAGAGTGACCGAA. Internal WT amplicon: 1248 bp. Deletion size: 707 bp. Deletion left flank: TAGCTTGTTTCAATGTTTTTGTTCAGGATT. Deletion right flank: TCGGAACTTCCCCACTCACCGACGAAGAGC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037325 Copy
http://www.wormbase.org/db/get?name=WBStrain00037331
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003938(pax-2)
Genomic Alteration: WBGene00003938(pax-2)
Availability: available
References:
Synonyms: pax-2(ok3078) IV.
Alternate IDs: WB-STRAIN:VC2438, CGC_VC2438
Notes: K06B9.5. External left primer: AGGCTAATGAAACGTGCCAA. External right primer: AATTTTCGAGTCGTTGGTCG. Internal left primer: ACAGAGAAATGGCGAGTTGC. Internal right primer: CACGTGGGTAATGTGGTACG. Internal WT amplicon: 1183 bp. Deletion size: 527 bp. Deletion left flank: AACTAAAAAGTGTACTTTATTGAGATTATA. Deletion right flank: GTGTTCTCCGACAAGTCCAGTAGGATAGAC. Insertion Sequence: GTGTACTTTATTGAGATTATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037331 Copy
http://www.wormbase.org/db/get?name=WBStrain00037334
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000405(cdk-1)|WBGene00001072(dpy-10)
Genomic Alteration: WBGene00000405(cdk-1), WBGene00001072(dpy-10)
Availability: available
References:
Synonyms: +/mT1 II; cdk-1(ok1881)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2446, CGC_VC2446
Notes: Mutagen:UV/TMP|"T05G5.3. Homozygous sterile deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1881 homozygotes (sterile Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: CACTAAGCAATGGTCTCGCA. External right primer: CGACAACAATGGAAACATCG. Internal left primer: CGCTTACGCCTTTTCTATCG. Internal right primer: ACCATTCTCTCGTGAATCCG. Internal WT amplicon: 2136 bp. Deletion size: 1140 bp. Deletion left flank: AATCGGCGAAGGAACATACGGAGTCGTCTA. Deletion right flank: TCGTCTTCCGTGTATTGTTTAACTATCACC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037334 Copy
http://www.wormbase.org/db/get?name=WBStrain00037332
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003527(nas-8)
Genomic Alteration: WBGene00003527(nas-8)
Availability: available
References:
Synonyms: nas-8(ok3137) IV.
Alternate IDs: WB-STRAIN:VC2439, CGC_VC2439
Notes: C34D4.9. External left primer: ACCATTATCCCACAAATGCC. External right primer: TGGAAGCTTCACATCACTGC. Internal left primer: TACACGAAAATGGCCAAATG. Internal right primer: ATTGGTACATCAGATTCATTTTTAA. Internal WT amplicon: 1132 bp. Deletion size: 422 bp. Deletion left flank: CTGCGTTCGATTTGTTCCTAGAACCGCTGT. Deletion right flank: TTGTATTTGCACAGTATAGATTTGCAAATC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037332 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
