Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 59 showing 1161 ~ 1180 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00040370

http://www.wormbase.org/db/get?name=WBStrain00040370

Source Database: WormBase (WB)
Affected Genes: WBGene00006795(unc-61)
Genomic Alteration: WBGene00006795(unc-61)
Availability: available
Source References: EMPTY
Synonyms: unc-61(n3169) V.
Alternate IDs: WB-STRAIN:WH202, CGC_WH202
Notes: Poor backward movement. Protrusive vulva. Gonad extrusion. Egg-laying defects. Recessive.

Proper citation: RRID:WB-STRAIN:WBStrain00040370 Copy   


  • RRID:WB-STRAIN:WBStrain00040377

http://www.wormbase.org/db/get?name=WBStrain00040377

Source Database: WormBase (WB)
Affected Genes: WBGene00001018(dnc-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001018(dnc-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:37684042
Synonyms: unc-119(ed3) III; ojIs57.
Alternate IDs: WB-STRAIN:WH258, CGC_WH258
Notes: ojIs57 [pie-1::GFP::dnc-2 + unc-119(+)]|"Supplementary_genotype unc-119(ed3) III; ojIs5"

Proper citation: RRID:WB-STRAIN:WBStrain00040377 Copy   


  • RRID:WB-STRAIN:WBStrain00040378

http://www.wormbase.org/db/get?name=WBStrain00040378

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)|WBGene00013168(arp-1)
Genomic Alteration: WBGene00006843(unc-119), WBGene00013168(arp-1)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ojIs47.
Alternate IDs: WB-STRAIN:WH259, CGC_WH259
Notes: ojIs47 [arp-1::GFP + unc-119(+)].

Proper citation: RRID:WB-STRAIN:WBStrain00040378 Copy   


  • RRID:WB-STRAIN:WBStrain00040308

http://www.wormbase.org/db/get?name=WBStrain00040308

Source Database: WormBase (WB)
Affected Genes: WBGene00013164(Y53F4B.18)
Genomic Alteration: WBGene00013164(Y53F4B.18)
Availability: available
Source References: EMPTY
Synonyms: Y53F4B.18(vq3) II.
Alternate IDs: WB-STRAIN:VV213, CGC_VV213
Notes: Made_by: Alan To|"Superficially wild-type. Reference: Chen AL, et al. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0243-4."

Proper citation: RRID:WB-STRAIN:WBStrain00040308 Copy   


  • RRID:WB-STRAIN:WBStrain00040309

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040309

Source Database: WormBase (WB)
Affected Genes: WBGene00015062(trx-1)
Genomic Alteration: WBGene00015062(trx-1)
Availability: available
Source References: PMID:37258276, PMID:38446031
Synonyms: trx-1(ok1449) II.
Alternate IDs: WB-STRAIN:VZ1, CGC_VZ1
Notes: B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.|"Made_by: A. Miranda Vizuete"|"Supplementary_genotype trx-1(ok1449)"

Proper citation: RRID:WB-STRAIN:WBStrain00040309 Copy   


  • RRID:WB-STRAIN:WBStrain00040383

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040383

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)|WBGene00006843(unc-119)|WBGene00016395(spcs-1)
Genomic Alteration: WBGene00004027(pie-1), WBGene00006843(unc-119), WBGene00016395(spcs-1)
Availability: available
Source References: PMID:30489010, PMID:37684042, PMID:39167497
Synonyms: unc-119(ed3) III; ojIs23.
Alternate IDs: WB-STRAIN:WH327, CGC_WH327
Notes: ojIs23 [pie-1p::GFP::C34B2.10].|"Reference WBPaper00055815 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype unc-119(ed3) III; ojIs23 [Ppie-1GFP::SP12]"

Proper citation: RRID:WB-STRAIN:WBStrain00040383 Copy   


  • RRID:WB-STRAIN:WBStrain00040386

http://www.wormbase.org/db/get?name=WBStrain00040386

Source Database: WormBase (WB)
Affected Genes: WBGene00004274(rab-11.1)
Genomic Alteration: WBGene00004274(rab-11.1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:WH0347
Notes: Retired following removal of zero padded strain public_names.

Proper citation: RRID:WB-STRAIN:WBStrain00040386 Copy   


  • RRID:WB-STRAIN:WBStrain00040380

http://www.wormbase.org/db/get?name=WBStrain00040380

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ojIs12.
Alternate IDs: WB-STRAIN:WH279, CGC_WH279
Notes: ojIs12 [cyk-4::GFP + unc-119(+)]. Strain is not very healthy. Described as integratred array but appears to segregate Uncs. Maintain at 15-20C.

Proper citation: RRID:WB-STRAIN:WBStrain00040380 Copy   


  • RRID:WB-STRAIN:WBStrain00040304

http://www.wormbase.org/db/get?name=WBStrain00040304

Source Database: WormBase (WB)
Affected Genes: WBGene00045328(mir-794)|WBGene00045329(mir-795)
Genomic Alteration: WBGene00045328(mir-794), WBGene00045329(mir-795)
Availability: available
Source References: EMPTY
Synonyms: mir-794 mir-795(maDf5) I.
Alternate IDs: WB-STRAIN:VT3301, CGC_VT3301
Notes: mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].

Proper citation: RRID:WB-STRAIN:WBStrain00040304 Copy   


  • RRID:WB-STRAIN:WBStrain00040303

http://www.wormbase.org/db/get?name=WBStrain00040303

Source Database: WormBase (WB)
Affected Genes: WBGene00045329(mir-795)
Genomic Alteration: WBGene00045329(mir-795)
Availability: available
Source References: EMPTY
Synonyms: mir-795(ma298) I; maIs105 V.
Alternate IDs: WB-STRAIN:VT3299, CGC_VT3299
Notes: maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].

Proper citation: RRID:WB-STRAIN:WBStrain00040303 Copy   


  • RRID:WB-STRAIN:WBStrain00040306

http://www.wormbase.org/db/get?name=WBStrain00040306

Source Database: WormBase (WB)
Affected Genes: WBGene00004780(ser-7)
Genomic Alteration: WBGene00004780(ser-7)
Availability: available
Source References: EMPTY
Synonyms: ser-7(vq2) X.
Alternate IDs: WB-STRAIN:VV207, CGC_VV207
Notes: CRISPR/Cas9-engineered knockout of ser-7. Resistant to exogenous serotonin induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.|"Made_by: Alan To"

Proper citation: RRID:WB-STRAIN:WBStrain00040306 Copy   


  • RRID:WB-STRAIN:WBStrain00040305

http://www.wormbase.org/db/get?name=WBStrain00040305

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001842(her-1)|WBGene00003598(nhl-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001842(her-1), WBGene00003598(nhl-2)
Availability: unknown
Source References: EMPTY
Synonyms: nDf50/mIn1 [mIs14 dpy-10(e128)] II; nhl-2(ok818) III; her-1(n695) V.
Alternate IDs: WB-STRAIN:VT3363
Notes: Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

Proper citation: RRID:WB-STRAIN:WBStrain00040305 Copy   


  • RRID:WB-STRAIN:WBStrain00040388

http://www.wormbase.org/db/get?name=WBStrain00040388

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:WH0351
Notes: Retired following removal of zero padded strain public_names.

Proper citation: RRID:WB-STRAIN:WBStrain00040388 Copy   


  • RRID:WB-STRAIN:WBStrain00040387

http://www.wormbase.org/db/get?name=WBStrain00040387

Source Database: WormBase (WB)
Affected Genes: WBGene00004274(rab-11.1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004274(rab-11.1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ojIs35.
Alternate IDs: WB-STRAIN:WH347, CGC_WH347
Notes: Made_by: Jane Squirrell|"ojIs35 [pie-1::GFP::rab-11.1 + unc-119(+)]."

Proper citation: RRID:WB-STRAIN:WBStrain00040387 Copy   


  • RRID:WB-STRAIN:WBStrain00040389

http://www.wormbase.org/db/get?name=WBStrain00040389

Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; ojIs37.
Alternate IDs: WB-STRAIN:WH351, CGC_WH351
Notes: Made_by: Jane Squirrell|"ojIs37 [pie-1p::GFP::ugtp-1 + unc-119(+)]. Maintain under normal conditions. Reference: Bembenek J, et al. Development. (2007) 134(21):3837-48."

Proper citation: RRID:WB-STRAIN:WBStrain00040389 Copy   


  • RRID:WB-STRAIN:WBStrain00040472

http://www.wormbase.org/db/get?name=WBStrain00040472

Source Database: WormBase (WB)
Affected Genes: WBGene00000232(avr-14)|WBGene00000233(avr-15)|WBGene00000254(bli-4)|WBGene00001591(glc-1)|WBGene00008400(drh-3)
Genomic Alteration: WBGene00000232(avr-14), WBGene00000233(avr-15), WBGene00000254(bli-4), WBGene00001591(glc-1), WBGene00008400(drh-3)
Availability: available
Source References: EMPTY
Synonyms: avr-14(ad1302) drh-3(tm1217) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); avr-15(ad1051) glc-1(pk54)) V.
Alternate IDs: WB-STRAIN:WM216, CGC_WM216
Notes: Heterozygotes are wild-type, GFP+ and sensitive to ivermectin. Segregates non-GFP drh-3 homozygotes (sterile, resisitant to ivermectin), arrested hT2 aneuploids, and wild-type GFP+ heterozygotes. Maintain by picking GFP+. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.

Proper citation: RRID:WB-STRAIN:WBStrain00040472 Copy   


  • RRID:WB-STRAIN:WBStrain00040473

http://www.wormbase.org/db/get?name=WBStrain00040473

Source Database: WormBase (WB)
Affected Genes: WBGene00008400(drh-3)
Genomic Alteration: WBGene00008400(drh-3)
Availability: available
Source References: EMPTY
Synonyms: drh-3(ne3197) I.
Alternate IDs: WB-STRAIN:WM230, CGC_WM230
Notes: Mutator. Dominant RNAi-deficient. Temperature-sensitive sterile. Maintain at 15-20C. ne3197 is a G840D missense mutation. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44.

Proper citation: RRID:WB-STRAIN:WBStrain00040473 Copy   


  • RRID:WB-STRAIN:WBStrain00040476

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040476

Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004178(prg-1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: prg-1(tm872) I; neSi14 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:WM274, CGC_WM274
Notes: neSi14 [FLAG::prg-1 + Cbr-unc-119(+)] II. MosSCI insertion into ttTi5605 (LG II). Reference: Lee HC, et al. Cell. 2012 Jul 6;150(1):78-87.

Proper citation: RRID:WB-STRAIN:WBStrain00040476 Copy   


  • RRID:WB-STRAIN:WBStrain00040478

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00040478

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: rde-3(ne3370) I.
Alternate IDs: WB-STRAIN:WM286, CGC_WM286
Notes: Made_by: Gisela Chen|"RNAi deficient. Temperature-sensitive sterile. In-frame deletion. Reference: Chen CC, et al. Curr Biol. 2005 Feb 22;15(4):378-83."

Proper citation: RRID:WB-STRAIN:WBStrain00040478 Copy   


  • RRID:WB-STRAIN:WBStrain00040407

http://www.wormbase.org/db/get?name=WBStrain00040407

Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00015267(chin-1)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00015267(chin-1)
Availability: available
Source References: EMPTY
Synonyms: chin-1(tm1909)/sC1 [dpy-1(s2170) let(gk597)] III; ddIs?.
Alternate IDs: WB-STRAIN:WH532, CGC_WH532
Notes: ddIs? [pie-1p::GFP::par-6 + unc-119(+)]. Maintain under normal conditions. Heterozygotes are WT, and segregate WT, occasional Dpy (non-let recombinant sC1 homozygotes), and nearly sterile tm1909 homozygotes. Pick WT and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.

Proper citation: RRID:WB-STRAIN:WBStrain00040407 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X