Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
VC40883 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039849 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001676(gpa-14) | WBGene00001676(gpa-14) | WB-STRAIN:WBStrain00039849 | WormBase (WB) | WB | available | WB-STRAIN:VC40883, CGC_VC40883 | 2026-07-25 10:24:55 | 0 | |||
|
VC40882 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039848 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039848 | WormBase (WB) | WB | available | WB-STRAIN:VC40882, CGC_VC40882 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40875 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039842 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039842 | WormBase (WB) | WB | available | WB-STRAIN:VC40875, CGC_VC40875 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40874 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039841 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039841 | WormBase (WB) | WB | available | WB-STRAIN:VC40874, CGC_VC40874 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40873 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039840 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039840 | WormBase (WB) | WB | available | WB-STRAIN:VC40873, CGC_VC40873 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40881 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039847 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039847 | WormBase (WB) | WB | available | WB-STRAIN:VC40881, CGC_VC40881 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40877 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039844 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039844 | WormBase (WB) | WB | available | WB-STRAIN:VC40877, CGC_VC40877 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40895 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039861 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039861 | WormBase (WB) | WB | available | WB-STRAIN:VC40895, CGC_VC40895 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40862 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039829 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039829 | WormBase (WB) | WB | available | WB-STRAIN:VC40862, CGC_VC40862 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40861 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039828 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039828 | WormBase (WB) | WB | available | WB-STRAIN:VC40861, CGC_VC40861 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40860 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039827 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5174 mutation is G->A, flanking sequences AAATCCCTAGAAAAAAATCGATTTTTTTCA and CTTCCACCGAAAATTCAACGTGTAGAATCC.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00012576(Y37H9A.1) | WBGene00012576(Y37H9A.1) | WB-STRAIN:WBStrain00039827 | WormBase (WB) | WB | available | WB-STRAIN:VC40860, CGC_VC40860 | 2026-07-25 10:24:55 | 0 | |||
|
VC40853 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039820 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039820 | WormBase (WB) | WB | available | WB-STRAIN:VC40853, CGC_VC40853 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40856 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039823 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039823 | WormBase (WB) | WB | available | WB-STRAIN:VC40856, CGC_VC40856 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40855 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039822 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039822 | WormBase (WB) | WB | available | WB-STRAIN:VC40855, CGC_VC40855 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40872 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039839 | Caenorhabditis elegans | Whole-genome sequenced strain. | Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5175 mutation is C->T, flanking sequences TCAATCCGCAAAAAGATGCAGAGAAGGTAA and TGAAAAATTGTGTAGGTAAGAAAAAAAAAA.|"Made_by: Vancouver KO Group"|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00012893(Y45F10D.15) | WBGene00012893(Y45F10D.15) | WB-STRAIN:WBStrain00039839 | WormBase (WB) | WB | available | WB-STRAIN:VC40872, CGC_VC40872 | 2026-07-25 10:24:55 | 0 | |||
|
VC40871 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039838 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039838 | WormBase (WB) | WB | available | WB-STRAIN:VC40871, CGC_VC40871 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40865 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039832 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039832 | WormBase (WB) | WB | available | WB-STRAIN:VC40865, CGC_VC40865 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40868 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039835 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039835 | WormBase (WB) | WB | available | WB-STRAIN:VC40868, CGC_VC40868 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40866 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039833 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039833 | WormBase (WB) | WB | available | WB-STRAIN:VC40866, CGC_VC40866 | 2026-07-25 10:24:55 | 0 | |||||
|
VC40964 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00039928 | Caenorhabditis elegans | Whole-genome sequenced strain. | Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WB-STRAIN:WBStrain00039928 | WormBase (WB) | WB | available | WB-STRAIN:VC40964, CGC_VC40964 | 2026-07-25 10:24:56 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
