Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00029230
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; ltIs105.
Alternate IDs: WB-STRAIN:OD178, CGC_OD178
Notes: ltIs105 [(pAA280) pie-1p::GFP::LAP::MVB-12 + unc-119(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00029230 Copy
http://www.wormbase.org/db/get?name=WBStrain00029231
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; ltIs79; pwIs116.
Alternate IDs: WB-STRAIN:OD179, CGC_OD179
Notes: ltIs79 [(pAA196) pie-1p::mCherry::rab-5 + unc-119(+)]. pwIs116 [rme-2p::rme-2::GFP::rme-2 3'UTR + unc-119(+)]. Maintain at 20-25C to reduce silencing of the array.
Proper citation: RRID:WB-STRAIN:WBStrain00029231 Copy
http://www.wormbase.org/db/get?name=WBStrain00029229
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; ltIs104.
Alternate IDs: WB-STRAIN:OD177, CGC_OD177
Notes: ltIs104 [(pAA277) pie-1p::GFP::LAP::vps-37 + unc-119(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00029229 Copy
http://www.wormbase.org/db/get?name=WBStrain00029225
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; ltIs78.
Alternate IDs: WB-STRAIN:OD142, CGC_OD142
Notes: ltIs78 [(pKO5) pie-1::GFP::TEV::Stag::air-1 spliced coding + unc-119(+)].|"Made_by: Oegema/Portier"
Proper citation: RRID:WB-STRAIN:WBStrain00029225 Copy
http://www.wormbase.org/db/get?name=WBStrain00029226
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OD146
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029226 Copy
http://www.wormbase.org/db/get?name=WBStrain00029227
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OD147
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029227 Copy
http://www.wormbase.org/db/get?name=WBStrain00029228
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004027(pie-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004027(pie-1), WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; ltIs103.
Alternate IDs: WB-STRAIN:OD176, CGC_OD176
Notes: ltIs103 [(pAA212) pie-1p::GFPLAP::cav-1 + unc-119(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00029228 Copy
http://www.wormbase.org/db/get?name=WBStrain00029267
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000254(bli-4)|WBGene00002004(hsf-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00002004(hsf-1)
Availability: available
References:
Synonyms: hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:OG576, CGC_OG576
Notes: Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]|"WBStrain provided so WBPaper00061869 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00029267 Copy
http://www.wormbase.org/db/get?name=WBStrain00029300
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001314(eno-4)|WBGene00006783(unc-47)
Genomic Alteration: WBGene00001314(eno-4), WBGene00006783(unc-47)
Availability: available
References:
Synonyms: eno-4(ot4) II; oxIs12 X.
Alternate IDs: WB-STRAIN:OH775, CGC_OH775
Notes: oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
Proper citation: RRID:WB-STRAIN:WBStrain00029300 Copy
http://www.wormbase.org/db/get?name=WBStrain00029301
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001534(gcy-7)
Genomic Alteration: WBGene00001534(gcy-7)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:OH811
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029301 Copy
http://www.wormbase.org/db/get?name=WBStrain00029260
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: drSi4 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:OG474, CGC_OG474
Notes: drSi4 [vha-6p::3XFLAG::pgp-3/CFTR(delta F508)::mCherry::unc-54 3'UTR] II. Superficially wild-type with mCherry expression only in the intestine with significantly diminished expression as compared to drSi2. Single copy integration of the vha-6 promoter driving the PGP-3 protein with an N-terminal 3XFLAG tag and a C-terminal mCherry tag. Amino acids 476-484 of PGP-3 have been replaced with amino acids 501-509 of human CFTR with F508 deleted (TIKENII_G). Transgene was inserted at the ttTi5605 locus on LGII and verified to be a single copy insertion by long range PCR across the genomic locus. Reference: He L, et al. Dis Model Mech. 2012 Nov;5(6):930-9.
Proper citation: RRID:WB-STRAIN:WBStrain00029260 Copy
http://www.wormbase.org/db/get?name=WBStrain00029254
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000914(daf-19)
Genomic Alteration: WBGene00000914(daf-19)
Availability: available
References:
Synonyms: daf-19(m86) II.
Alternate IDs: WB-STRAIN:OE3063, CGC_OE3063
Notes: Daf-c. Dyf. Maintain at 15C.
Proper citation: RRID:WB-STRAIN:WBStrain00029254 Copy
http://www.wormbase.org/db/get?name=WBStrain00029255
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: oqEx500.
Alternate IDs: WB-STRAIN:OEB730, CGC_OEB730
Notes: oqEx500 [tmem-107::GFP + unc-122p::DsRed]. Pick DsRed+ animals to maintain. TMEM-107::GFP accumulates in the ciliary transition zones of ciliated neurons. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.
Proper citation: RRID:WB-STRAIN:WBStrain00029255 Copy
http://www.wormbase.org/db/get?name=WBStrain00029256
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00043308(tmem-107)
Genomic Alteration: WBGene00043308(tmem-107)
Availability: available
References:
Synonyms: tmem-107(oq100) I.
Alternate IDs: WB-STRAIN:OEB800, CGC_OEB800
Notes: F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.
Proper citation: RRID:WB-STRAIN:WBStrain00029256 Copy
http://www.wormbase.org/db/get?name=WBStrain00029257
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; drEx206.
Alternate IDs: WB-STRAIN:OG153, CGC_OG153
Notes: drEx206 [hsf-1p::hsf-1::YFP::unc-54 3'UTR + unc-119(+)]. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
Proper citation: RRID:WB-STRAIN:WBStrain00029257 Copy
http://www.wormbase.org/db/get?name=WBStrain00029251
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
References:
Synonyms: lin-15B&lin-15A(n765) X; ofEx4.
Alternate IDs: WB-STRAIN:OE3010, CGC_OE3010
Notes: Made_by: A. Miranda Vizuete|"ofEx4 [trx-1::GFP + lin-15(+)]. Animals with the array are non-Muv. Animals which have lost the array are Muv. lin-15(n765) is temperature sensitive. GFP expression in ASJ neurons and to some extent in posterior-most intestinal cells."
Proper citation: RRID:WB-STRAIN:WBStrain00029251 Copy
http://www.wormbase.org/db/get?name=WBStrain00029247
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001867(him-8)|WBGene00007552(dyf-4)
Genomic Alteration: WBGene00001867(him-8), WBGene00007552(dyf-4)
Availability: available
References:
Synonyms: him-8(e1489) IV; dyf-4(m158) V.
Alternate IDs: WB-STRAIN:OE3001, CGC_OE3001
Notes: Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males.
Proper citation: RRID:WB-STRAIN:WBStrain00029247 Copy
http://www.wormbase.org/db/get?name=WBStrain00029249
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00016025(xbx-4)
Genomic Alteration: WBGene00016025(xbx-4)
Availability: available
References:
Synonyms: xbx-4(ok635) IV.
Alternate IDs: WB-STRAIN:OE3003, CGC_OE3003
Notes: Mutagen:UV/TMP|"No obvious phenotype."
Proper citation: RRID:WB-STRAIN:WBStrain00029249 Copy
http://www.wormbase.org/db/get?name=WBStrain00029320
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: otIs138 X.
Alternate IDs: WB-STRAIN:OH1422, CGC_OH1422
Notes: Made_by: Reenal/Adam|"otIs138 [ser-2(prom3)::GFP + rol-6(su1006)] X. Integrated array derived from otEx449."
Proper citation: RRID:WB-STRAIN:WBStrain00029320 Copy
http://www.wormbase.org/db/get?name=WBStrain00029323
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001864(him-5)|WBGene00002988(lim-6)|WBGene00006525(tax-2)
Genomic Alteration: WBGene00001864(him-5), WBGene00002988(lim-6), WBGene00006525(tax-2)
Availability: available
References:
Synonyms: tax-2(ot25) otIs114 I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:OH1571, CGC_OH1571
Notes: otIs114 [lim-6p::GFP + rol-6(su1006)]. Ectopic lim-6 expression in a set of cells anterior to ASE. Molecular identity: W40Stop. Null allele.
Proper citation: RRID:WB-STRAIN:WBStrain00029323 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
