Organisms   Select Another Resource Report Type

http://www.wormbase.org/db/get?name=WBStrain00037962

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006744(unc-4)|WBGene00019025(srb-16)
Genomic Alteration: WBGene00006744(unc-4), WBGene00019025(srb-16)
Availability: available
References:
Synonyms: srb-16(gk774) unc-4(e120) II.
Alternate IDs: WB-STRAIN:VC10071, CGC_VC10071
Notes: F58A6.6. Unc. External left primer: AAGTGGTTTTGGGTCTGACG. External right primer: GTACCGCCGCAAGAATGTAT. Internal left primer: GCCGCCACGAGTTAATAGAA. Internal right primer: TGTTGGCCCTGATTTCTTTC. Internal WT amplicon: 4857 bp. Deletion size: 3522 bp. Deletion left flank: ACGATTTTTGCACAAAAAACCCCTCCAAAC. Deletion right flank: GTCGTTTGCTTGTTTCATCTTCATCATTGC.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037962 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037966

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006744(unc-4)
Genomic Alteration: WBGene00006744(unc-4)
Availability: available
References:
Synonyms: unc-4(e120) Y46E12BL.2(gk801gk909) II.
Alternate IDs: WB-STRAIN:VC10077, CGC_VC10077
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y46E12BL.2. Unc. External left primer: ATCCACAATGCTCCGATCTC. External right primer: TCTGGCTTGCTTTTGTGATG. External WT amplicon: 540 bp. This strain contains two point mutations in Y46E12BL.2. The first is gk801, which is a G->A mutation at Y46E12BL coordinate 21938 (flanking sequences GTTCTTGAAGCTATACGGCTTTACACAGAA and TTACTCCAGCCGATCTGGTCACCCGTTATG). The second is gk909, which is an A->G mutation at Y46E12BL coordinate 21966 (flanking sequences AAGTTACTCCAGCCGATCTGGTCACCCGTT and TGTCGATAGTGCGATCGCCAAGTCCAAGGA)."

Proper citation: RRID:WB-STRAIN:WBStrain00037966 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037963

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006744(unc-4)|WBGene00015061(cpna-2)
Genomic Alteration: WBGene00006744(unc-4), WBGene00015061(cpna-2)
Availability: available
References:
Synonyms: cpna-2(gk775) unc-4(e120) II.
Alternate IDs: WB-STRAIN:VC10072, CGC_VC10072
Notes: B0228.4. Unc. External left primer: GCTCAAAGCTCCGAAACAAC. External right primer: CCCACAAGATTGGTAAGCGT. External WT amplicon: 876 bp. Deletion size: 153 bp. Deletion left flank: AGTTAGACACACTGAAAATGCTGGAAAGGT. Deletion right flank: CAGAAGCCTTGCTCCGTCGGCATCTGAGTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037963 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037964

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006744(unc-4)
Genomic Alteration: WBGene00006744(unc-4)
Availability: available
References:
Synonyms: T28D9(gk776) unc-4(e120) II.
Alternate IDs: WB-STRAIN:VC10073, CGC_VC10073
Notes: Mutagen:UV/TMP|"T28D9. Unc. External left primer: CATTTCGGAACGTTTCCATC. External right primer: TCTGCTTCGTACTTTGCTGC. External WT amplicon: 1121 bp. Deletion size: 436 bp. Deletion left flank: TTTTTTACGTGAATCTTTTTTTTTTCAGAA. Deletion right flank: CAAGTTGTGAATTTTCGAACATCCGTCGAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037964 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037979

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC10129, CGC_VC10129
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00037979 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037970

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006744(unc-4)
Genomic Alteration: WBGene00006744(unc-4)
Availability: available
References:
Synonyms: K05F6(gk907) unc-4(e120) II.
Alternate IDs: WB-STRAIN:VC10109, CGC_VC10109
Notes: K05F6.2. Unc. External left primer: ACAAATTCCCTTTGTCGTCG. External right primer: TGGATGAGCAGCTGGTAAGA. External WT amplicon: 200 bp. This strain carries a point mutation in K05F6.2. The mutation is gk907, which is a T->A mutation at K05F6 coordinate 21364 (flanking sequences AAATCAAAAACTCTGTTTGATGGATATCTA and ATGCCTTTAAATGATCTACTTCTTACCAGC).|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037970 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037977

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC10127, CGC_VC10127
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data."|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037977 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037947

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006705(ubc-8)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006705(ubc-8), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: ubc-8(gk5273[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4187, CGC_VC4187
Notes: Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 2819 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037947 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037945

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: gkDf69[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] V.
Alternate IDs: WB-STRAIN:VC4174, CGC_VC4174
Notes: Homozygous viable. Deletion of 7975 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGTCTGATTATCAATTGAAACCTTTG ; Right flanking sequence: CAAAGGTTTCAATTGATAATCAGACTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037945 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037944

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021941(lgc-33)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021941(lgc-33)
Availability: available
References:
Synonyms: lgc-33(gk5257[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4171, CGC_VC4171
Notes: Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037944 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00038000

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20024, CGC_VC20024
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038000 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037957

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000252(bli-2)|WBGene00001072(dpy-10)|WBGene00006744(unc-4)|WBGene00020368(ast-1)
Genomic Alteration: WBGene00000252(bli-2), WBGene00001072(dpy-10), WBGene00006744(unc-4), WBGene00020368(ast-1)
Availability: available
References:
Synonyms: ast-1(gk463) bli-2(e768) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC10005, CGC_VC10005
Notes: Mutagen:UV/TMP|"T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037957 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037953

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: F42F12.3(gk5201[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4215, CGC_VC4215
Notes: Homozygous viable. Deletion of 1066 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCAGTTTTGATTTTAAAGGTATTCCGATG ; Right flanking sequence: ATCGGCATCTAATTTCTAATGCTTCAAGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037953 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037925

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00005815(srw-68)
Genomic Alteration: WBGene00005815(srw-68)
Availability: available
References:
Synonyms: srw-68(gk5203) V.
Alternate IDs: WB-STRAIN:VC4123, CGC_VC4123
Notes: Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5203 mutation is C->T, flanking sequences TGATGAAATTTTTATGCTAGAATTTTCGAA and CTATTTTCCGATCCATTTCGTTGTGATATC.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037925 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037927

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004227(ptr-13)
Genomic Alteration: WBGene00004227(ptr-13)
Availability: available
References:
Synonyms: ptr-13(gk5205) II.
Alternate IDs: WB-STRAIN:VC4125, CGC_VC4125
Notes: Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5205 mutation is C->T, flanking sequences CAGAGGATACGATAGATTGACCCCAGGCAT and CATTCGATTGCAAGTAGTTTCTAAACCAGT.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037927 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037928

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011260(cnnm-5)|WBGene00013865(ZC334.7)|WBGene00021471(Y39G10AR.15)
Genomic Alteration: WBGene00011260(cnnm-5), WBGene00013865(ZC334.7), WBGene00021471(Y39G10AR.15)
Availability: available
References:
Synonyms: Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III.
Alternate IDs: WB-STRAIN:VC4126, CGC_VC4126
Notes: Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037928 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037922

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000992(dhs-29)
Genomic Alteration: WBGene00000992(dhs-29)
Availability: available
References:
Synonyms: dhs-29(gk5199) X.
Alternate IDs: WB-STRAIN:VC4120, CGC_VC4120
Notes: Homozygous viable. Splicing allele identified by amplicon sequencing. The gk5199 mutation is C->T, flanking sequences AGCGACCGGCACACTTGAAGAGAGCAGAAA and TGAAATAAAAAATTAGATTTTATCATGTTA.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037922 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037920

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006365(syg-1)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006365(syg-1), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: syg-1(gk5167[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4109, CGC_VC4109
Notes: Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037920 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00037938

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004227(ptr-13)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004227(ptr-13), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Alternate IDs: WB-STRAIN:VC4160, CGC_VC4160
Notes: Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00037938 Copy   

•   Source: Integrated Animals

http://www.wormbase.org/db/get?name=WBStrain00038038

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20069, CGC_VC20069
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00038038 Copy   

•   Source: Integrated Animals