Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037823
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: C15A7.2(gk3798[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC3831, CGC_VC3831
Notes: Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATGTCACAATGTTATCCACAATGTTCACCA; Right flanking sequence: CAAAATATAGAAGGAGCATTTGAGTTGGGT. See WormBase Variation gk3798 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037823 Copy
http://www.wormbase.org/db/get?name=WBStrain00037821
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00004768(sel-11)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00004768(sel-11), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: sel-11(gk3792[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Alternate IDs: WB-STRAIN:VC3824, CGC_VC3824
Notes: Homozygous viable. Deletion of 2037 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTGGCTCGTGTGTGGCGACTGCGGCCA; Right flanking sequence: CGGACCGTCAACAGATCAAGTCACTTCGGA. See WormBase Variation gk3792 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037821 Copy
http://www.wormbase.org/db/get?name=WBStrain00037837
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00007200(vamp-8)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00007200(vamp-8)
Availability: available
References:
Synonyms: vamp-8(gk3845[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3892, CGC_VC3892
Notes: Homozygous viable. Deletion of 1092 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCAGTTCCTATTTCAAACAAAAAAACTCCA; Right flanking sequence: GGGCTTGTTGCTGTCGTTTTCCATTGACTG. See WormBase Variation gk3845 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037837 Copy
http://www.wormbase.org/db/get?name=WBStrain00037804
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00044699(nhr-286)
Genomic Alteration: WBGene00044699(nhr-286)
Availability: available
References:
Synonyms: nhr-286(gk3859) V.
Alternate IDs: WB-STRAIN:VC3625, CGC_VC3625
Notes: Homozygous viable. Deletion of 72 bp with AAAAAAAAAA inserted at break. Left flanking sequence: GGCTATAAGAAGTTGGAGTGCATAAATGAC; Right flanking sequence: TTTTGATCTCAGTTATTACATTAATCAAGG. See WormBase Variation gk3859 for details.
Proper citation: RRID:WB-STRAIN:WBStrain00037804 Copy
http://www.wormbase.org/db/get?name=WBStrain00037802
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00004856(sma-2)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00004856(sma-2)
Availability: available
References:
Synonyms: sma-2(ok3109)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:VC3575, CGC_VC3575
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK370.2. Apparent homozygous lethal deletion chromosome balanced by glp-1- and dpy-19-marked recombination suppressor. Heterozygotes are WT, and segregate WT, sterile ts-Dpy qC1 homozygotes, and ok3109 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTCGCTGATTCCAGTCGTTT. External right primer: AGCTAAATCCGCACACGAAC. Internal left primer: TAAACAGCATGCGGTGGAAT. Internal right primer: TGAAAAATTTGGCTCCGAGT. Internal WT amplicon: 1222 bp. Deletion size: 707 bp. Deletion left flank: AATAACTTTGAGAGGGAAAAGGTTACGAAA. Deletion right flank: TCACTGAAGATTTTCGATATGGAGATTTTT. Insertion sequence: TCACTGAAGATTTTCGATATGTATTTGAGAGGGAAAAGGTTACGAAA."
Proper citation: RRID:WB-STRAIN:WBStrain00037802 Copy
http://www.wormbase.org/db/get?name=WBStrain00037803
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020823(pole-3)
Genomic Alteration: WBGene00020823(pole-3)
Availability: available
References:
Synonyms: T26A5.8(gk3858) III.
Alternate IDs: WB-STRAIN:VC3622, CGC_VC3622
Notes: Homozygous viable. Deletion of 7 bp. Left flanking sequence: AGCCTTCTGCTGACTAATAACTTTCCATTT; Right flanking sequence: GCGGACTTGCACTGGAAATTTTAATTTCTT. See WormBase Variation gk3858 for details.
Proper citation: RRID:WB-STRAIN:WBStrain00037803 Copy
http://www.wormbase.org/db/get?name=WBStrain00037808
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004309(rap-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004309(rap-3), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: rap-3(gk3695[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3737, CGC_VC3737
Notes: Homozygous viable. Deletion of 536 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTAGTTCTTTAAATGACTACTGTAGTGT; Right flanking sequence: TGGTAACTAATCTCAAATAGATTTTAAATT. See WormBase Variation gk3695 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037808 Copy
http://www.wormbase.org/db/get?name=WBStrain00037809
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: C52B11.5(gk3700[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC3742, CGC_VC3742
Notes: Homozygous viable. Deletion of 1047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTATTTGGACAACGCTCTGTGCACAAATCA; Right flanking sequence: TGGCTTAACGAATGAAGATAATGGATTCAA. See WormBase Variation gk3700 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037809 Copy
http://www.wormbase.org/db/get?name=WBStrain00037888
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: H23N18.4(gk5109[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Alternate IDs: WB-STRAIN:VC4036, CGC_VC4036
Notes: Homozygous viable. Deletion of 2206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGTTGCATAAAAAACTACAAAATGATGCT ; Right flanking sequence: TTTGGGAAAATAAAACATGCCCAGAACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037888 Copy
http://www.wormbase.org/db/get?name=WBStrain00037889
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: C10C5.3(gk5112[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC4038, CGC_VC4038
Notes: Homozygous viable. Deletion of 1852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAATACGGTAAGTAATGTCTTATGCCTGCG ; Right flanking sequence: CCAGGTATTGAAATCTACCAAACGCTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037889 Copy
http://www.wormbase.org/db/get?name=WBStrain00037891
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: C34D10.2(gk5116[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4042, CGC_VC4042
Notes: Homozygous viable. Deletion of 6402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTATTTTCAACGCTGGCCAACCGCCG ; Right flanking sequence: CTCGTCAACTCATCTTCTACCAAATTTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037891 Copy
http://www.wormbase.org/db/get?name=WBStrain00037815
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: F11A10.7(gk3769[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Alternate IDs: WB-STRAIN:VC3802, CGC_VC3802
Notes: Homozygous viable. Deletion of 857 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGATCAGCCGTACTATTGATACTCTATG; Right flanking sequence: TGGACGATCATGTGATTCGTGTTGACAAAG. See WormBase Variation gk3769 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037815 Copy
http://www.wormbase.org/db/get?name=WBStrain00037817
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: gkDf63[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] X.
Alternate IDs: WB-STRAIN:VC3805, CGC_VC3805
Notes: Homozygous viable. Deletion of 5664 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACCAAACTAAACGCTCTGGACGTGAACATG; Right flanking sequence: GGGGCGCATTTATAGCAAAAACTTCCCAAT. See WormBase Rearrangement gkDf63 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037817 Copy
http://www.wormbase.org/db/get?name=WBStrain00037818
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: available
References:
Synonyms: gkDf64[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] III.
Alternate IDs: WB-STRAIN:VC3807, CGC_VC3807
Notes: Homozygous viable. Deletion of 17117 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGTCCTCAACTTTTCATTCTGTTGTA; Right flanking sequence: AGGAAATTGTCCCACAAGTTTGAAATGGTA. See WormBase Rearrangement gkDf64 for details.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037818 Copy
http://www.wormbase.org/db/get?name=WBStrain00037896
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008629(cpt-5)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008629(cpt-5)
Availability: available
References:
Synonyms: cpt-5(gk5128[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Alternate IDs: WB-STRAIN:VC4054, CGC_VC4054
Notes: Homozygous viable. Deletion of 2432 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GTCAATAAAATGTAGCATTAAGTGTAGCCA ; Right flanking sequence: ATGTATGTTTTCCGAATTATTTTTCGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037896 Copy
http://www.wormbase.org/db/get?name=WBStrain00037811
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00014058(ZK673.2)|WBGene00022642(lipl-5)
Genomic Alteration: WBGene00014058(ZK673.2), WBGene00022642(lipl-5)
Availability: available
References:
Synonyms: ZK673.2(gk3749) II; lipl-5(gk3748) V.
Alternate IDs: WB-STRAIN:VC3788, CGC_VC3788
Notes: Homozygous viable. Nonsense alleles identified by amplicon sequencing.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037811 Copy
http://www.wormbase.org/db/get?name=WBStrain00037897
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00020130(igcm-2)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00020130(igcm-2)
Availability: available
References:
Synonyms: igcm-2(gk5129[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4055, CGC_VC4055
Notes: Homozygous viable. Deletion of 4249 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAAAACAACAACAAATATTACGAACCATA ; Right flanking sequence: CCTTACATTCAAATATTAAATCAGCTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 4249 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGAGCTGATTTAATATTTGAATGTAAGG; Right flanking sequence: TTATGGTTCGTAATATTTGTTGTTGTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037897 Copy
http://www.wormbase.org/db/get?name=WBStrain00037810
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001660(gop-1)|WBGene00014058(ZK673.2)
Genomic Alteration: WBGene00001660(gop-1), WBGene00014058(ZK673.2)
Availability: available
References:
Synonyms: ZK673.2(gk3749) II; gop-1(gk3747) III.
Alternate IDs: WB-STRAIN:VC3787, CGC_VC3787
Notes: Homozygous viable. Nonsense alleles identified by amplicon sequencing.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037810 Copy
http://www.wormbase.org/db/get?name=WBStrain00037898
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022418(igcm-4)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022418(igcm-4)
Availability: available
References:
Synonyms: igcm-4(gk5130[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Alternate IDs: WB-STRAIN:VC4056, CGC_VC4056
Notes: Homozygous viable. Deletion of 2727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTATTGTTTCTTTGTTGAATATGGTATG ; Right flanking sequence: TCTTTACCTGCTCTCCATTTTTAGACCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037898 Copy
http://www.wormbase.org/db/get?name=WBStrain00037989
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20012, CGC_VC20012
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037989 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
