Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 2 showing 21 ~ 40 out of 64 results
Snippet view Table view Download 64 Result(s)
Click the to add this resource to a Collection

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688004

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688004
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688004 Copy   


  • RRID:RGD_6484574

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484574

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6484574
Notes: This strain was produced by injecting ZFNs targeting the sequence CACCACATGCTCCTGccaggCAGGCTTCACTGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 104-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_6484574 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484579

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6484579
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is an 11-bp deletion in exon 2.

Proper citation: RRID:RGD_6484579 Copy   


  • RRID:RGD_6893440

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893440

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893440
Notes: This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4.

Proper citation: RRID:RGD_6893440 Copy   


  • RRID:RGD_60986

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=60986

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 60986
Notes: Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center

Proper citation: RRID:RGD_60986 Copy   


  • RRID:RGD_60987

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=60987

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 60987
Notes: Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).

Proper citation: RRID:RGD_60987 Copy   


  • RRID:RGD_61011

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61011

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 61011
Notes: Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).

Proper citation: RRID:RGD_61011 Copy   


  • RRID:RGD_10026

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10026

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 10026
Notes: To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.

Proper citation: RRID:RGD_10026 Copy   


  • RRID:RGD_68058

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68058

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68058
Notes: Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974).

Proper citation: RRID:RGD_68058 Copy   


  • RRID:RGD_68119

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=68119

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Availability: Extinct
Alternate IDs: 68119
Notes: Reserved symbol for strain in development now at F6 (NIH 1989).

Proper citation: RRID:RGD_68119 Copy   


  • RRID:RRRC_00239

    This resource has 10+ mentions.

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=728193

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: outbred
Availability: Extinct
Alternate IDs: RGD_728193, 728193, RRRC_239, RRRC_0239, RRRC_00239
Notes: To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center

Proper citation: RRID:RRRC_00239 Copy   


  • RRID:RGD_5687992

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687992

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687992
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5687992 Copy   


  • RRID:RGD_5687987

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687987

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5687987
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5687987 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688006

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688006
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688006 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688002

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5688002
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688002 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893437

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893437
Notes: This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.

Proper citation: RRID:RGD_6893437 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893443

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 6893443
Notes: This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 7-bp deletin in exon 5.

Proper citation: RRID:RGD_6893443 Copy   


  • RRID:RGD_4139879

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 4139879
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.

Proper citation: RRID:RGD_4139879 Copy   


  • RRID:RGD_5508371

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5508371
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_5508371 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509997

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Extinct
Alternate IDs: 5509997
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.

Proper citation: RRID:RGD_5509997 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X