Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
NM3159 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029070 | Caenorhabditis elegans | jsIs423. | jsIs423 [rbf-1::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions. Reference: Mahoney TR., et al. Mol Biol Cell. 2006 Jun;17(6):2617-25. | WB-STRAIN:WBStrain00029070 | WormBase (WB) | WB | available | WB-STRAIN:NM3159, CGC_NM3159 | 2026-07-25 10:22:31 | 0 | |||||
|
NM3458 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029071 | Caenorhabditis elegans | aex-4(n2415) X; jsEx1028. | jsEx1028 [aex-4p::GFP::aex + myo-2p::GFP + pBS]. Pick GFP+ to maintain. Reference: Mahoney TR, et al. Proc Natl Acad Sci U S A. 2008 Oct 21;105(42):16350-5. | WBGene00006454(aex-4) | WBGene00006454(aex-4) | WB-STRAIN:WBStrain00029071 | WormBase (WB) | WB | available | WB-STRAIN:NM3458, CGC_NM3458 | 2026-07-25 10:22:30 | 0 | |||
|
NL3909 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029023 | Caenorhabditis elegans | unc-119(ed3) III; pkIs1642. | pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029023 | WormBase (WB) | WB | available | PMID:21938067 PMID:31704915 |
WB-STRAIN:NL3909, CGC_NL3909 | 2026-07-25 10:22:30 | 0 | ||
|
NL4110 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029026 | Caenorhabditis elegans | prg-1 (pk2298) I. | Superficially wildtype. | WBGene00004178(prg-1) | WBGene00004178(prg-1) | WB-STRAIN:WBStrain00029026 | WormBase (WB) | WB | available | WB-STRAIN:NL4110, CGC_NL4110 | 2026-07-25 10:22:30 | 0 | |||
|
NL3848 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029020 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00001088(dpy-30) | WBGene00001088(dpy-30) | WB-STRAIN:WBStrain00029020 | WormBase (WB) | WB | unknown | WB-STRAIN:NL3848 | 2026-07-25 10:22:30 | 0 | |||
|
NL3630 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029017 | Caenorhabditis elegans | pkIs32 III; eri-1(mg366) IV. | pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive. | WBGene00001332(eri-1)|WBGene00004027(pie-1) | WBGene00001332(eri-1), WBGene00004027(pie-1) | WB-STRAIN:WBStrain00029017 | WormBase (WB) | WB | available | WB-STRAIN:NL3630, CGC_NL3630 | 2026-07-25 10:22:30 | 0 | |||
|
NL3643 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029018 | Caenorhabditis elegans | unc-22(st136) IV. | Alt Genotype: unc-22(st136)|"Contains Construct Originally made by Dr. Nadine Vastenhouw."|"The unc-22(st136) allele harbors a transposon insertion. Animals have a twitcher phenotype."|"Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc." | WBGene00006759(unc-22) | WBGene00006759(unc-22) | WB-STRAIN:WBStrain00029018 | WormBase (WB) | WB | available | PMID:37078421 | WB-STRAIN:NL3643, CGC_NL3643 | 2026-07-25 10:22:30 | 0 | ||
|
NL3401 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00029014 | Caenorhabditis elegans | pkIs1605. | pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers. | WBGene00002016(hsp-16.2) | WBGene00002016(hsp-16.2) | WB-STRAIN:WBStrain00029014 | WormBase (WB) | WB | available | WB-STRAIN:NL3401, CGC_NL3401 | 2026-07-25 10:22:30 | 1 | |||
|
NL3511 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00029015 | Caenorhabditis elegans | ppw-1(pk1425) I. | Mutagen:UV/TMP|"ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [ppw1(pk1425)"|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data." | WBGene00004093(ppw-1) | WBGene00004093(ppw-1) | WB-STRAIN:WBStrain00029015 | WormBase (WB) | WB | available | PMID:31717869 PMID:32943454 PMID:36176234 PMID:37865119 |
WB-STRAIN:NL3511, CGC_NL3511 | 2026-07-25 10:22:30 | 2 | ||
|
NP1154 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029096 | Caenorhabditis elegans | unc-119(ed3) III; cdIs141. | cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.|"cdIs141[pcc1::mCherry::RAB-7 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029096 | WormBase (WB) | WB | available | WB-STRAIN:NP1154, CGC_NP1154 | 2026-07-25 10:22:31 | 0 | |||
|
NP1360 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029097 | Caenorhabditis elegans | arIs37 I; cup-14(cd31) II. | arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.|"Made_by: Daniel Zamora" | WBGene00013093(cup-14) | WBGene00013093(cup-14) | WB-STRAIN:WBStrain00029097 | WormBase (WB) | WB | available | WB-STRAIN:NP1360, CGC_NP1360 | 2026-07-25 10:22:32 | 0 | |||
|
NL3304 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029010 | Caenorhabditis elegans | rsd-4(pk3304) III. | Made_by: K.L. Okihara|"Resistant to feeding dsRNA but sensitive to dsRNA injection." | WBGene00004683(rsd-4) | WBGene00004683(rsd-4) | WB-STRAIN:WBStrain00029010 | WormBase (WB) | WB | available | WB-STRAIN:NL3304, CGC_NL3304 | 2026-07-25 10:22:30 | 0 | |||
|
NL3307 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029011 | Caenorhabditis elegans | rsd-2(pk3307). | Made_by: K.L. Okihara|"Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP)."|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data." | WBGene00004681(rsd-2) | WBGene00004681(rsd-2) | WB-STRAIN:WBStrain00029011 | WormBase (WB) | WB | available | PMID:32338603 | WB-STRAIN:NL3307, CGC_NL3307 | 2026-07-25 10:22:30 | 0 | ||
|
NQ792 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029099 | Caenorhabditis elegans | qnIs303 IV; dmsr-1(qn45) V. | Made_by: Mike Iannacone|"qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017." | WBGene00010191(dmsr-1) | WBGene00010191(dmsr-1) | WB-STRAIN:WBStrain00029099 | WormBase (WB) | WB | available | WB-STRAIN:NQ792, CGC_NQ792 | 2026-07-25 10:22:31 | 0 | |||
|
NP941 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029092 | Caenorhabditis elegans | unc-119(ed3) III; cdIs85. | cdIs85 [pcc1::2xFYVE::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter.|"cdIs85 [pcc1::2xFYVE::GFP + unc-119(+) + myo-2::GFP]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029092 | WormBase (WB) | WB | available | WB-STRAIN:NP941, CGC_NP941 | 2026-07-25 10:22:31 | 0 | |||
|
NP1086 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029094 | Caenorhabditis elegans | unc-119(ed3) III; cdIs113. | cdIs113 [pcc1::mCherry::rab-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter.|"cdIs113[pcc1::mCherry::RAB-5 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029094 | WormBase (WB) | WB | available | WB-STRAIN:NP1086, CGC_NP1086 | 2026-07-25 10:22:32 | 0 | |||
|
NP1129 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029095 | Caenorhabditis elegans | unc-119(ed3) III; cdIs131. | cdIs131 [pcc1::GFP::rab-5 + myo-2p::GFP + unc-119(+)]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter.|"cdIs131[pcc1::GFP::RAB-5 + unc-119(+) + myo-2::GFP]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter." | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029095 | WormBase (WB) | WB | available | WB-STRAIN:NP1129, CGC_NP1129 | 2026-07-25 10:22:31 | 0 | |||
|
NP898 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029091 | Caenorhabditis elegans | cdIs80. | cdIs80 [pcc1::PLCd::GFP + rol-6(su1006)]. Rollers. | WB-STRAIN:WBStrain00029091 | WormBase (WB) | WB | available | WB-STRAIN:NP898, CGC_NP898 | 2026-07-25 10:22:32 | 0 | |||||
|
NL3223 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029007 | Caenorhabditis elegans | nxf-1(pk386) V. | Suppressor of activated Gs. Temperature sensitive allele. | WBGene00003834(nxf-1) | WBGene00003834(nxf-1) | WB-STRAIN:WBStrain00029007 | WormBase (WB) | WB | available | WB-STRAIN:NL3223, CGC_NL3223 | 2026-07-25 10:22:30 | 0 | |||
|
NY2066 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00029166 | Caenorhabditis elegans | ynIs66 IV; him-5(e1490) V. | ynIs66 [flp-7p::GFP]. | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00029166 | WormBase (WB) | WB | available | WB-STRAIN:NY2066, CGC_NY2066 | 2026-07-25 10:22:33 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
