Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
On page 19 showing 361 ~ 380 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:WB-STRAIN:WBStrain00029070

http://www.wormbase.org/db/get?name=WBStrain00029070

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: jsIs423.
Alternate IDs: WB-STRAIN:NM3159, CGC_NM3159
Notes: jsIs423 [rbf-1::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions. Reference: Mahoney TR., et al. Mol Biol Cell. 2006 Jun;17(6):2617-25.

Proper citation: RRID:WB-STRAIN:WBStrain00029070 Copy   

    • RRID:WB-STRAIN:WBStrain00029071

http://www.wormbase.org/db/get?name=WBStrain00029071

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006454(aex-4)
Genomic Alteration: WBGene00006454(aex-4)
Availability: available
References:
Synonyms: aex-4(n2415) X; jsEx1028.
Alternate IDs: WB-STRAIN:NM3458, CGC_NM3458
Notes: jsEx1028 [aex-4p::GFP::aex + myo-2p::GFP + pBS]. Pick GFP+ to maintain. Reference: Mahoney TR, et al. Proc Natl Acad Sci U S A. 2008 Oct 21;105(42):16350-5.

Proper citation: RRID:WB-STRAIN:WBStrain00029071 Copy   

    • RRID:WB-STRAIN:WBStrain00029023

http://www.wormbase.org/db/get?name=WBStrain00029023

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; pkIs1642.
Alternate IDs: WB-STRAIN:NL3909, CGC_NL3909
Notes: pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."

Proper citation: RRID:WB-STRAIN:WBStrain00029023 Copy   

    • RRID:WB-STRAIN:WBStrain00029026

http://www.wormbase.org/db/get?name=WBStrain00029026

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004178(prg-1)
Genomic Alteration: WBGene00004178(prg-1)
Availability: available
References:
Synonyms: prg-1 (pk2298) I.
Alternate IDs: WB-STRAIN:NL4110, CGC_NL4110
Notes: Superficially wildtype.

Proper citation: RRID:WB-STRAIN:WBStrain00029026 Copy   

    • RRID:WB-STRAIN:WBStrain00029020

http://www.wormbase.org/db/get?name=WBStrain00029020

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001088(dpy-30)
Genomic Alteration: WBGene00001088(dpy-30)
Availability: unknown
References:
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NL3848
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00029020 Copy   

    • RRID:WB-STRAIN:WBStrain00029017

http://www.wormbase.org/db/get?name=WBStrain00029017

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001332(eri-1)|WBGene00004027(pie-1)
Genomic Alteration: WBGene00001332(eri-1), WBGene00004027(pie-1)
Availability: available
References:
Synonyms: pkIs32 III; eri-1(mg366) IV.
Alternate IDs: WB-STRAIN:NL3630, CGC_NL3630
Notes: pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.

Proper citation: RRID:WB-STRAIN:WBStrain00029017 Copy   

    • RRID:WB-STRAIN:WBStrain00029018

http://www.wormbase.org/db/get?name=WBStrain00029018

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
References:
Synonyms: unc-22(st136) IV.
Alternate IDs: WB-STRAIN:NL3643, CGC_NL3643
Notes: Alt Genotype: unc-22(st136)|"Contains Construct Originally made by Dr. Nadine Vastenhouw."|"The unc-22(st136) allele harbors a transposon insertion. Animals have a twitcher phenotype."|"Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc."

Proper citation: RRID:WB-STRAIN:WBStrain00029018 Copy   

    • RRID:WB-STRAIN:WBStrain00029014

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029014

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: available
References:
Synonyms: pkIs1605.
Alternate IDs: WB-STRAIN:NL3401, CGC_NL3401
Notes: pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.

Proper citation: RRID:WB-STRAIN:WBStrain00029014 Copy   

    • RRID:WB-STRAIN:WBStrain00029015

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029015

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004093(ppw-1)
Genomic Alteration: WBGene00004093(ppw-1)
Availability: available
References:
Synonyms: ppw-1(pk1425) I.
Alternate IDs: WB-STRAIN:NL3511, CGC_NL3511
Notes: Mutagen:UV/TMP|"ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [ppw1(pk1425)"|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00029015 Copy   

    • RRID:WB-STRAIN:WBStrain00029096

http://www.wormbase.org/db/get?name=WBStrain00029096

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs141.
Alternate IDs: WB-STRAIN:NP1154, CGC_NP1154
Notes: cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.|"cdIs141[pcc1::mCherry::RAB-7 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter."

Proper citation: RRID:WB-STRAIN:WBStrain00029096 Copy   

    • RRID:WB-STRAIN:WBStrain00029097

http://www.wormbase.org/db/get?name=WBStrain00029097

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013093(cup-14)
Genomic Alteration: WBGene00013093(cup-14)
Availability: available
References:
Synonyms: arIs37 I; cup-14(cd31) II.
Alternate IDs: WB-STRAIN:NP1360, CGC_NP1360
Notes: arIs37 [myo-3p::ssGFP + dpy-20(+)] I. myo-3p::ssGFP is a secreted GFP that is taken up by coelomocytes. Reference: Gee, K et al. (2017) G3 7: 991.|"Made_by: Daniel Zamora"

Proper citation: RRID:WB-STRAIN:WBStrain00029097 Copy   

    • RRID:WB-STRAIN:WBStrain00029010

http://www.wormbase.org/db/get?name=WBStrain00029010

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004683(rsd-4)
Genomic Alteration: WBGene00004683(rsd-4)
Availability: available
References:
Synonyms: rsd-4(pk3304) III.
Alternate IDs: WB-STRAIN:NL3304, CGC_NL3304
Notes: Made_by: K.L. Okihara|"Resistant to feeding dsRNA but sensitive to dsRNA injection."

Proper citation: RRID:WB-STRAIN:WBStrain00029010 Copy   

    • RRID:WB-STRAIN:WBStrain00029011

http://www.wormbase.org/db/get?name=WBStrain00029011

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004681(rsd-2)
Genomic Alteration: WBGene00004681(rsd-2)
Availability: available
References:
Synonyms: rsd-2(pk3307).
Alternate IDs: WB-STRAIN:NL3307, CGC_NL3307
Notes: Made_by: K.L. Okihara|"Resistant when fed dsRNA. Contains a point mutation at position 13832 (c to t) (R1000 STOP)."|"WBStrain mapped, WBPaper00059605 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00029011 Copy   

    • RRID:WB-STRAIN:WBStrain00029099

http://www.wormbase.org/db/get?name=WBStrain00029099

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010191(dmsr-1)
Genomic Alteration: WBGene00010191(dmsr-1)
Availability: available
References:
Synonyms: qnIs303 IV; dmsr-1(qn45) V.
Alternate IDs: WB-STRAIN:NQ792, CGC_NQ792
Notes: Made_by: Mike Iannacone|"qnIs303 [hsp-16.2p::flp-13 + hsp-16.2p::GFP + rab-3p::mCherry] IV. Pumps and moves 2 hours after heat induced flp-13 over-expression. Outcrossed 1x to NQ570. Reference: Iannacone M, et al. eLife 2017."

Proper citation: RRID:WB-STRAIN:WBStrain00029099 Copy   

    • RRID:WB-STRAIN:WBStrain00029092

http://www.wormbase.org/db/get?name=WBStrain00029092

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs85.
Alternate IDs: WB-STRAIN:NP941, CGC_NP941
Notes: cdIs85 [pcc1::2xFYVE::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter.|"cdIs85 [pcc1::2xFYVE::GFP + unc-119(+) + myo-2::GFP]. Ballistic transformation. 2xFYVE(Hrs)::GFP expressed in front coelomocyte promoter."

Proper citation: RRID:WB-STRAIN:WBStrain00029092 Copy   

    • RRID:WB-STRAIN:WBStrain00029094

http://www.wormbase.org/db/get?name=WBStrain00029094

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs113.
Alternate IDs: WB-STRAIN:NP1086, CGC_NP1086
Notes: cdIs113 [pcc1::mCherry::rab-5 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter.|"cdIs113[pcc1::mCherry::RAB-5 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-5 expressed in front coelomocyte promoter."

Proper citation: RRID:WB-STRAIN:WBStrain00029094 Copy   

    • RRID:WB-STRAIN:WBStrain00029095

http://www.wormbase.org/db/get?name=WBStrain00029095

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
References:
Synonyms: unc-119(ed3) III; cdIs131.
Alternate IDs: WB-STRAIN:NP1129, CGC_NP1129
Notes: cdIs131 [pcc1::GFP::rab-5 + myo-2p::GFP + unc-119(+)]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter.|"cdIs131[pcc1::GFP::RAB-5 + unc-119(+) + myo-2::GFP]. Ballistic transformation. GFP::RAB-5 expressed in front coelomocyte promoter."

Proper citation: RRID:WB-STRAIN:WBStrain00029095 Copy   

    • RRID:WB-STRAIN:WBStrain00029091

http://www.wormbase.org/db/get?name=WBStrain00029091

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: cdIs80.
Alternate IDs: WB-STRAIN:NP898, CGC_NP898
Notes: cdIs80 [pcc1::PLCd::GFP + rol-6(su1006)]. Rollers.

Proper citation: RRID:WB-STRAIN:WBStrain00029091 Copy   

    • RRID:WB-STRAIN:WBStrain00029007

http://www.wormbase.org/db/get?name=WBStrain00029007

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003834(nxf-1)
Genomic Alteration: WBGene00003834(nxf-1)
Availability: available
References:
Synonyms: nxf-1(pk386) V.
Alternate IDs: WB-STRAIN:NL3223, CGC_NL3223
Notes: Suppressor of activated Gs. Temperature sensitive allele.

Proper citation: RRID:WB-STRAIN:WBStrain00029007 Copy   

    • RRID:WB-STRAIN:WBStrain00029166

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00029166

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: available
References:
Synonyms: ynIs66 IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:NY2066, CGC_NY2066
Notes: ynIs66 [flp-7p::GFP].

Proper citation: RRID:WB-STRAIN:WBStrain00029166 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the ASWG Community.

Recent News Entries

Is the future of peer review automated?

Automated screening of COVID-19 preprints: can we help authors to improve transparency and reproducibility?

rTransparent

Contact Us

Our Information

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch