Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RM1677 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033384 | Caenorhabditis elegans | unc-41(md152) V. | unc-41(md152) is a 1 bp deletion after amino acid 872 in exon 8 producing GLHKS*. wt sequence: GCTAACTCTTGTGCAGCCCG. md152 sequence: GCTAACTCTTGTGCAGCCCA. | WBGene00006777(unc-41) | WBGene00006777(unc-41) | WB-STRAIN:WBStrain00033384 | WormBase (WB) | WB | unknown | WB-STRAIN:RM1677 | 2026-09-12 11:16:54 | 0 | |||
|
RM1702 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033385 | Caenorhabditis elegans | ric-8(md303) IV. | Made_by: J. Rand/K. Miller|"Ric, Egl, severely locomotion defective, reduced body flexion/straight posture, pharyngeal pumping and growth rate slightly lower than WT. Does not reproduce at 25C. Brood size about 1/10 of WT at 20C, and about 1/3 of WT at 14C. 29% of eggs do not hatch. Early embryogenesis defects include misalignment of mitotic spindles and delayed migration of nuclei. Grows best at 14C but you can still work with it and do crosses at 20C." | WBGene00004367(ric-8) | WBGene00004367(ric-8) | WB-STRAIN:WBStrain00033385 | WormBase (WB) | WB | available | PMID:8901627 | WB-STRAIN:RM1702, CGC_RM1702 | 2026-09-12 11:16:54 | 0 | ||
|
RM1845 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033387 | Caenorhabditis elegans | cat-1(e1111) X. | Catecholamine abnormal. See Duerr JS, et al. J Neurosci. 1999 Jan 1;19(1):72-84. for description of phenotypes. | WBGene00000295(cat-1) | WBGene00000295(cat-1) | WB-STRAIN:WBStrain00033387 | WormBase (WB) | WB | available | WB-STRAIN:RM1845, CGC_RM1845 | 2026-09-12 11:16:54 | 0 | |||
|
RM2037 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033389 | Caenorhabditis elegans | unc-17(e245) cho-1(tm373) IV. | Loosely-linked (~12 cM apart) cholinergic mutants. Aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. cho-1(tm373) is a null deletion allele of the gene encoding the plasma membrane choline transporter, and unc-17(e245) is a strong missense allele of the synaptic vesicle acetylcholine transporter. References: Mullen GP, et al. Genetics. 2007 Sep;177(1):195-204.|"Made_by: Mai Vu" | WBGene00000501(cho-1)|WBGene00006756(unc-17) | WBGene00000501(cho-1), WBGene00006756(unc-17) | WB-STRAIN:WBStrain00033389 | WormBase (WB) | WB | available | WB-STRAIN:RM2037, CGC_RM2037 | 2026-09-12 11:16:54 | 0 | |||
|
RM2431 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033392 | Caenorhabditis elegans | unc-13(md2415)/hT1 I; +/hT1 V. | Heterozygotes are WT and segregate WT, hT1 homozygotes (mid-larval lethals), md2415 homozygotes (generally L1 lethals which are almost completely paralyzed and have a coily posture with some head movement), and dead eggs. md2415 has a 2.7 kb deletion in the unc-13R region.|"Made_by: Moulder/Eustance-Koh"|"Mutagen: Psoralen"|"Supplementary_genotype unc-13(md2415)/hT1 I; +/hT1 V." | WBGene00006752(unc-13) | WBGene00006752(unc-13) | WB-STRAIN:WBStrain00033392 | WormBase (WB) | WB | available | PMID:36617680 | WB-STRAIN:RM2431, CGC_RM2431 | 2026-09-12 11:16:54 | 0 | ||
|
RE666 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033316 | Caenorhabditis elegans | ire-1(v33) II. | Made_by: X. Shen|"Slow growth. Abnormal tail."|"Supplementary_genotype ire-1(v33) II" | WBGene00002147(ire-1) | WBGene00002147(ire-1) | WB-STRAIN:WBStrain00033316 | WormBase (WB) | WB | available | PMID:33542359 PMID:36924492 PMID:39436952 |
WB-STRAIN:RE666, CGC_RE666 | 2026-09-12 11:16:53 | 2 | ||
|
RFK607 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033318 | Caenorhabditis elegans | gtsf-1(xf43) IV. | Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. | WBGene00020286(gtsf-1) | WBGene00020286(gtsf-1) | WB-STRAIN:WBStrain00033318 | WormBase (WB) | WB | available | WB-STRAIN:RFK607, CGC_RFK607 | 2026-09-12 11:16:53 | 0 | |||
|
RFK608 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033319 | Caenorhabditis elegans | gtsf-1(xf44) IV. | Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325. | WBGene00020286(gtsf-1) | WBGene00020286(gtsf-1) | WB-STRAIN:WBStrain00033319 | WormBase (WB) | WB | available | WB-STRAIN:RFK608, CGC_RFK608 | 2026-09-12 11:16:53 | 0 | |||
|
RM2710 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033395 | Caenorhabditis elegans | snf-11(ok156) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"No obvious phenotype."|"Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30." | WBGene00004910(snf-11) | WBGene00004910(snf-11) | WB-STRAIN:WBStrain00033395 | WormBase (WB) | WB | available | PMID:31415799 | WB-STRAIN:RM2710, CGC_RM2710 | 2026-09-12 11:16:54 | 1 | ||
|
RM2711 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033396 | Caenorhabditis elegans | unc-25(e156) III; snf-11(ok156) V. | Superficially similar to unc-25 mutants (Shrinker, Exp, etc.), except that unc-25-dependent behaviors are not rescued by exogenous GABA. Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30. | WBGene00004910(snf-11)|WBGene00006762(unc-25) | WBGene00004910(snf-11), WBGene00006762(unc-25) | WB-STRAIN:WBStrain00033396 | WormBase (WB) | WB | available | WB-STRAIN:RM2711, CGC_RM2711 | 2026-09-12 11:16:54 | 0 | |||
|
RC399 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033310 | Caenorhabditis elegans | mett-10(g38) dpy-18(e364) III. | Dpy. Maternal effect temperature sensitive embryonic lethal - leaky. Maintain at 15C. mett-10 was formerly known as let-42. | WBGene00001077(dpy-18)|WBGene00014228(mett-10) | WBGene00001077(dpy-18), WBGene00014228(mett-10) | WB-STRAIN:WBStrain00033310 | WormBase (WB) | WB | available | PMID:7250492 | WB-STRAIN:RC399, CGC_RC399 | 2026-09-12 11:16:53 | 0 | ||
|
RDV55 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033312 | Caenorhabditis elegans | rdvIs1 III. | rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. Maintain at 20C. Reference: Ou G, et al. Science. 2010 Oct 29;330(6004):677-80.|"Supplementary_genotype rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III" | WB-STRAIN:WBStrain00033312 | WormBase (WB) | WB | available | PMID:37651423 PMID:39525282 |
WB-STRAIN:RDV55, CGC_RDV55 | 2026-09-12 11:16:53 | 0 | ||||
|
RL67 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033369 | Caenorhabditis elegans | lon-1(e185) let-711(it150) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. | Heterozygotes are WT and segregate WT, Dpy Steriles, and Lon Uncs which are temperature sensitive maternal effect lethals. Embryos from homozygyous it150 hermaphrodites have spindle orientation defects at second and third cleave at 25C.|"Made_by: L. DeBella/L. Rose" | WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00002845(let-711)|WBGene00003055(lon-1)|WBGene00006768(unc-32) | WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00002845(let-711), WBGene00003055(lon-1), WBGene00006768(unc-32) | WB-STRAIN:WBStrain00033369 | WormBase (WB) | WB | available | WB-STRAIN:RL67, CGC_RL67 | 2026-09-12 11:16:54 | 0 | |||
|
RG3036 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033362 | Caenorhabditis elegans | irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of irg-7. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00018237(irg-7) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00018237(irg-7) | WB-STRAIN:WBStrain00033362 | WormBase (WB) | WB | available | WB-STRAIN:RG3036, CGC_RG3036 | 2026-09-12 11:16:53 | 0 | |||
|
RG3039 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033365 | Caenorhabditis elegans | spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. | F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of F40F11.4. Insertion site verified by PCR. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, ve539 homozygotes (Ste, lays only oocytes, GFP+ mKate-), Vul nT1 homozygotes (brighter mKate2+) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaactcacAAATAACTTTGTACCG Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAAT" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009589(spe-36) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009589(spe-36) | WB-STRAIN:WBStrain00033365 | WormBase (WB) | WB | available | WB-STRAIN:RG3039, CGC_RG3039 | 2026-09-12 11:16:54 | 0 | |||
|
RG3041 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033366 | Caenorhabditis elegans | K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of K06A9.3. Insertion site verified by PCR. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: gaatcacaaaaaattatgttttttt Right flanking sequence: GGAGGGGCACATAGAATCAATCATG" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00033366 | WormBase (WB) | WB | available | WB-STRAIN:RG3041, CGC_RG3041 | 2026-09-12 11:16:54 | 0 | |||
|
RJP255 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033367 | Caenorhabditis elegans | ynIs34 IV; him-5(e1490) V. | Made_by: unknown|"ynIs34 [flp-19p::GFP] IV. Him. Transcriptional flp-19 reporter. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785. Clark SG & Chiu C. Development. 2003 Aug;130(16):3781-94. Kim K & Li C. J Comp Neurol. 2004 Aug 2;475(4):540-50." | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00033367 | WormBase (WB) | WB | available | WB-STRAIN:RJP255, CGC_RJP255 | 2026-09-12 11:16:54 | 0 | |||
|
RM2754 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00033400 | Caenorhabditis elegans | dnj-14(ok237) X. | Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.|"Made_by: OMRF Knockout Group" | WBGene00001032(dnj-14) | WBGene00001032(dnj-14) | WB-STRAIN:WBStrain00033400 | WormBase (WB) | WB | available | WB-STRAIN:RM2754, CGC_RM2754 | 2026-09-12 11:16:54 | 1 | |||
|
RK1 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033368 | Caenorhabditis elegans | unc-13(e323) I; jsIs1. | jsIs1 [(pSB120) snb-1::GFP + rol-6(su1006)]. Roller Unc.|"Made_by: Guziewicz/Vitullo" | WBGene00006752(unc-13) | WBGene00006752(unc-13) | WB-STRAIN:WBStrain00033368 | WormBase (WB) | WB | available | WB-STRAIN:RK1, CGC_RK1 | 2026-09-12 11:16:54 | 0 | |||
|
RL104 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00033370 | Caenorhabditis elegans | ifet-1(it149) dpy-17(e164)/qC1 [dpy-19(e1259) glp-1(q339)] III. | Heterozygotes are WT and segregate WT and sterile Dpys. Referenced in Li, W. et al. J Cell Bio 187(1):33-42 (2009).|"Made_by: Wei Li / L Rose" | WBGene00001076(dpy-17)|WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00004132(ifet-1) | WBGene00001076(dpy-17), WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00004132(ifet-1) | WB-STRAIN:WBStrain00033370 | WormBase (WB) | WB | available | WB-STRAIN:RL104, CGC_RL104 | 2026-09-12 11:16:54 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.