Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
NL1909
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028981 Caenorhabditis elegans acy-1(pk867) III; dpy-20(e1362) IV; pkIs296 X. pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) WB-STRAIN:WBStrain00028981 WormBase (WB) WB available WB-STRAIN:NL1909, CGC_NL1909 2026-07-25 10:22:29 0
NL1921
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028982 Caenorhabditis elegans acy-1(pk880) III; dpy-20(e1362) IV; pkIs296 X. pkIs296 [hsp::gsa-1(Q208L) + dpy-20(+)] X. Heat-shock promoter driving expression of constitutively active gsa-1 transgene. Suppressor of activated Gs. sgs-1 also called acy-1. WBGene00000068(acy-1)|WBGene00001079(dpy-20)|WBGene00002016(hsp-16.2) WBGene00000068(acy-1), WBGene00001079(dpy-20), WBGene00002016(hsp-16.2) WB-STRAIN:WBStrain00028982 WormBase (WB) WB available WB-STRAIN:NL1921, CGC_NL1921 2026-07-25 10:22:29 0
NL1832
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028976 Caenorhabditis elegans T24C4.1(pk732) III. EMPTY WBGene00020757(ucr-2.3) WBGene00020757(ucr-2.3) WB-STRAIN:WBStrain00028976 WormBase (WB) WB available WB-STRAIN:NL1832, CGC_NL1832 2026-07-25 10:22:29 0
NL1834
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028977 Caenorhabditis elegans mut-9(pk734) Mutator. WBGene00003506(mut-9) WBGene00003506(mut-9) WB-STRAIN:WBStrain00028977 WormBase (WB) WB available WB-STRAIN:NL1834, CGC_NL1834 2026-07-25 10:22:30 0
NL1838
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00028978 Caenorhabditis elegans mut-14(pk738) Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA. WBGene00003507(mut-14) WBGene00003507(mut-14) WB-STRAIN:WBStrain00028978 WormBase (WB) WB available WB-STRAIN:NL1838, CGC_NL1838 2026-07-25 10:22:29 1
NL1888
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028979 Caenorhabditis elegans pash-1(pk2083)/+ I; pkIs2084. pkIs2084 [col-10::LacZ::lin-41 + goa-1::GFP]. Heterozygous. pash-1(pk2083)/+ heterozygotes look wild-type and will segregate pash-1(pk2083)/+ heterozygotes, sterile pk2083 homozygotes, and wild-type. Pick wild-type heterozygotes and check for segregation of sterile progeny to maintain. WBGene00011908(pash-1) WBGene00011908(pash-1) WB-STRAIN:WBStrain00028979 WormBase (WB) WB available WB-STRAIN:NL1888, CGC_NL1888 2026-07-25 10:22:29 0
NL1820
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028975 Caenorhabditis elegans mut-7(pk720) III. Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator. WBGene00003504(mut-7) WBGene00003504(mut-7) WB-STRAIN:WBStrain00028975 WormBase (WB) WB available WB-STRAIN:NL1820, CGC_NL1820 2026-07-25 10:22:29 0
NL737
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028929 Caenorhabditis elegans rde-3(r459) I; mek-1(pk97) X. K08A8.1 Previously called kin-17(pk97). WBGene00003185(mek-1) WBGene00003185(mek-1) WB-STRAIN:WBStrain00028929 WormBase (WB) WB available WB-STRAIN:NL737, CGC_NL737 2026-07-25 10:22:29 0
NL713
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028920 Caenorhabditis elegans rde-3(r459) I; sox-2(pk65). K08A8.2. Location of the insertion: TCACGTATCT TA CATATTATAT.|"Made_by: M Vroomen" WBGene00004949(sox-2) WBGene00004949(sox-2) WB-STRAIN:WBStrain00028920 WormBase (WB) WB available WB-STRAIN:NL713, CGC_NL713 2026-07-25 10:22:29 0
NL687
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028914 Caenorhabditis elegans dcr-1(pk1351)/+ III. Heterozygotes are WT and segregate WT and animals with protruding vulvas (dcr-1 homozygotes).|"Made_by: Fischer/Thijssen"|"Mutagen:UV/TMP"|"no longer available from the CGC." WBGene00000939(dcr-1) WBGene00000939(dcr-1) WB-STRAIN:WBStrain00028914 WormBase (WB) WB available WB-STRAIN:NL687, CGC_NL687 2026-07-25 10:22:29 0
NL706
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028916 Caenorhabditis elegans rde-3(r459) cap-1(pk56::Tc1) I. Made_by M. Vroomen|"Made_by: M. Vroomen" WBGene00000292(cap-1) WBGene00000292(cap-1) WB-STRAIN:WBStrain00028916 WormBase (WB) WB available WB-STRAIN:NL706, CGC_NL706 2026-07-25 10:22:28 0
NL2330
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028998 Caenorhabditis elegans gpa-13(pk1270) V. Made_by: WBGene00001675(gpa-13) WBGene00001675(gpa-13) WB-STRAIN:WBStrain00028998 WormBase (WB) WB available PMID:10192394 WB-STRAIN:NL2330, CGC_NL2330 2026-07-25 10:22:30 0
NL594
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028911 Caenorhabditis elegans gpa-12(pk322) X. Deletion sequence: Flanking undeleted sequence in uppercase, deleted sequence in lower case: CGGTGAATCTggaaagtccacg . . . aaatgcttatTCACAATGTT . WBGene00001674(gpa-12) WBGene00001674(gpa-12) WB-STRAIN:WBStrain00028911 WormBase (WB) WB available PMID:10192394
PMID:37527037
WB-STRAIN:NL594, CGC_NL594 2026-07-25 10:22:29 0
NL2331
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028999 Caenorhabditis elegans gpa-16(pk481)/bli-3(e767) I. Heterozygotes are WT and segregate WT, blistered, and lethals. pk481 previously called spn-1. WBGene00000253(bli-3)|WBGene00001678(gpa-16) WBGene00000253(bli-3), WBGene00001678(gpa-16) WB-STRAIN:WBStrain00028999 WormBase (WB) WB available WB-STRAIN:NL2331, CGC_NL2331 2026-07-25 10:22:29 0
NL2098
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00028994 Caenorhabditis elegans rrf-1(pk1417) I. Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants."|"Mutagen:UV/TMP"|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"WBStrain mapped, WBPaper00060738 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061852 paper added based on AFP_Strain data." WBGene00004508(rrf-1) WBGene00004508(rrf-1) WB-STRAIN:WBStrain00028994 WormBase (WB) WB available PMID:31717869
PMID:32943454
PMID:33289480
PMID:33319173
PMID:33594200
PMID:34449775
WB-STRAIN:NL2098, CGC_NL2098 2026-07-25 10:22:29 1
NL2511
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00029001 Caenorhabditis elegans msh-6(pk2504) I. Mutator phenotype. Enhanced level of spontaneous mutations (frameshifts and single base pair substitutions). The genomic region that is deleted in NL2511 is from nt 24180-25956 (takes out exon 5 and part of exon 6). WBGene00003422(msh-6) WBGene00003422(msh-6) WB-STRAIN:WBStrain00029001 WormBase (WB) WB available WB-STRAIN:NL2511, CGC_NL2511 2026-07-25 10:22:30 0
NL1140
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028948 Caenorhabditis elegans dpy-20(e1282) IV; pkIs379. pkIs379 [gpa-5XS(+) dpy-20(+)]. Not know to which LG the insertion is attached. WBGene00001079(dpy-20) WBGene00001079(dpy-20) WB-STRAIN:WBStrain00028948 WormBase (WB) WB available PMID:10192394 WB-STRAIN:NL1140, CGC_NL1140 2026-07-25 10:22:29 0
NL1142
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028949 Caenorhabditis elegans gpa-8(pk345) V. Made_by: WBGene00001670(gpa-8) WBGene00001670(gpa-8) WB-STRAIN:WBStrain00028949 WormBase (WB) WB available PMID:10192394 WB-STRAIN:NL1142, CGC_NL1142 2026-07-25 10:22:29 0
NL1000
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028943 Caenorhabditis elegans cdh-3(pk87) III. 2.6 kb deletion. pk87 homozygotes have a variable defect in hyp10 morphogenesis; most obvious in L1-L2 larvae. Rescued by WT copy of cdh-3 present on cosmid ZK112.|"mut-2 background" WBGene00000395(cdh-3) WBGene00000395(cdh-3) WB-STRAIN:WBStrain00028943 WormBase (WB) WB available PMID:9012534 WB-STRAIN:NL1000, CGC_NL1000 2026-07-25 10:22:29 0
NL1100
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00028944 Caenorhabditis elegans rde-3(r459) I; prk-1(pk86::Tc1) III. Insertion in CCTTCAGAAG TA TGTCATTTGG. WBGene00004182(prk-1) WBGene00004182(prk-1) WB-STRAIN:WBStrain00028944 WormBase (WB) WB available WB-STRAIN:NL1100, CGC_NL1100 2026-07-25 10:22:29 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.