Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB1091 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031795 | Caenorhabditis elegans | Y64G10A.7(ok1062) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp." | WBGene00013416(Y64G10A.7) | WBGene00013416(Y64G10A.7) | WB-STRAIN:WBStrain00031795 | WormBase (WB) | WB | available | WB-STRAIN:RB1091, CGC_RB1091 | 2026-09-12 11:16:30 | 0 | |||
|
RB1089 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031793 | Caenorhabditis elegans | hpl-1(ok1060) X. | K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001995(hpl-1) | WBGene00001995(hpl-1) | WB-STRAIN:WBStrain00031793 | WormBase (WB) | WB | available | WB-STRAIN:RB1089, CGC_RB1089 | 2026-09-12 11:16:30 | 0 | |||
|
RB1006 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031715 | Caenorhabditis elegans | C08B6.4(ok890) V. | C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007425(cht-5) | WBGene00007425(cht-5) | WB-STRAIN:WBStrain00031715 | WormBase (WB) | WB | available | WB-STRAIN:RB1006, CGC_RB1006 | 2026-09-12 11:16:29 | 0 | |||
|
RB1004 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031713 | Caenorhabditis elegans | K08E3.4(ok925). | K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010664(dbn-1) | WBGene00010664(dbn-1) | WB-STRAIN:WBStrain00031713 | WormBase (WB) | WB | available | WB-STRAIN:RB1004, CGC_RB1004 | 2026-09-12 11:16:29 | 0 | |||
|
RB1002 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031711 | Caenorhabditis elegans | T19D2.1(ok923) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020567(adt-3) | WBGene00020567(adt-3) | WB-STRAIN:WBStrain00031711 | WormBase (WB) | WB | available | WB-STRAIN:RB1002, CGC_RB1002 | 2026-09-12 11:16:29 | 0 | |||
|
RB1095 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031799 | Caenorhabditis elegans | chup-1(ok1073) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp." | WBGene00006477(chup-1) | WBGene00006477(chup-1) | WB-STRAIN:WBStrain00031799 | WormBase (WB) | WB | available | WB-STRAIN:RB1095, CGC_RB1095 | 2026-09-12 11:16:31 | 0 | |||
|
RB1001 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031710 | Caenorhabditis elegans | C01F6.1(ok922) IV. | C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007221(cpna-3) | WBGene00007221(cpna-3) | WB-STRAIN:WBStrain00031710 | WormBase (WB) | WB | available | WB-STRAIN:RB1001, CGC_RB1001 | 2026-09-12 11:16:29 | 0 | |||
|
RB1093 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031797 | Caenorhabditis elegans | C08H9.2(ok1071) II. | C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007463(vgln-1) | WBGene00007463(vgln-1) | WB-STRAIN:WBStrain00031797 | WormBase (WB) | WB | available | WB-STRAIN:RB1093, CGC_RB1093 | 2026-09-12 11:16:30 | 0 | |||
|
RB1009 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031718 | Caenorhabditis elegans | Y48C3A.14(ok929) II. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break." | WBGene00012995(top-3B) | WBGene00012995(top-3B) | WB-STRAIN:WBStrain00031718 | WormBase (WB) | WB | available | WB-STRAIN:RB1009, CGC_RB1009 | 2026-09-12 11:16:29 | 1 | |||
|
RB1182 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031883 | Caenorhabditis elegans | tba-1(ok1123) I. | F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006528(tba-1) | WBGene00006528(tba-1) | WB-STRAIN:WBStrain00031883 | WormBase (WB) | WB | available | WB-STRAIN:RB1182, CGC_RB1182 | 2026-09-12 11:16:32 | 0 | |||
|
RB1179 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031880 | Caenorhabditis elegans | C55C2.1(ok1228) I. | C55C2.1 Homozygous. Outer Left Sequence: gtcccatatgcttcttccca. Outer Right Sequence: aatccaagattcaaggcacg. Inner Left Sequence: tgtgaattgggtgagagcag. Inner Right Sequence: ttggcgtttttgtgtctctg. Inner Primer PCR Length: 2206. Estimated Deletion Size: about 1100 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016948(scrt-1) | WBGene00016948(scrt-1) | WB-STRAIN:WBStrain00031880 | WormBase (WB) | WB | available | WB-STRAIN:RB1179, CGC_RB1179 | 2026-09-12 11:16:32 | 0 | |||
|
RB1187 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031888 | Caenorhabditis elegans | tbx-41(ok1231) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006560(tbx-41) | WBGene00006560(tbx-41) | WB-STRAIN:WBStrain00031888 | WormBase (WB) | WB | available | WB-STRAIN:RB1187, CGC_RB1187 | 2026-09-12 11:16:32 | 0 | |||
|
RB1185 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031886 | Caenorhabditis elegans | tba-1(ok1135) I. | F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006528(tba-1) | WBGene00006528(tba-1) | WB-STRAIN:WBStrain00031886 | WormBase (WB) | WB | available | WB-STRAIN:RB1185, CGC_RB1185 | 2026-09-12 11:16:32 | 1 | |||
|
RB1101 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031805 | Caenorhabditis elegans | scpl-1(ok1080) I. | B0379.4 Homozygous. Outer Left Sequence: GAAGAACCGGGAGTCAACTG. Outer Right Sequence: AATTTTGAGGGCAGCTACGA. Inner Left Sequence: TTGAAAATTGGAACGAAGGC. Inner Right Sequence: AAGTATGCGGGAACCACAAC. Inner Primer PCR Length: 2908. Estimated Deletion Size: about 900 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007054(scpl-1) | WBGene00007054(scpl-1) | WB-STRAIN:WBStrain00031805 | WormBase (WB) | WB | available | WB-STRAIN:RB1101, CGC_RB1101 | 2026-09-12 11:16:31 | 0 | |||
|
RB1193 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031894 | Caenorhabditis elegans | F44D12.9(ok1238) IV. | F44D12.9 Homozygous. Outer Left Sequence: AGCCAAGATTTGGGCCTACT. Outer Right Sequence: TGCACCATATCCGTGTGACT. Inner Left Sequence: ACATGCTTGTTTTTGGGGAA. Inner Right Sequence: AATGGGTGTACTGGCGACTC. Inner Primer PCR Length: 2230. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00009686(ent-7) | WBGene00009686(ent-7) | WB-STRAIN:WBStrain00031894 | WormBase (WB) | WB | available | WB-STRAIN:RB1193, CGC_RB1193 | 2026-09-12 11:16:32 | 1 | |||
|
RB1192 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031893 | Caenorhabditis elegans | C24G7.4(ok1237) I. | C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016066(acd-2) | WBGene00016066(acd-2) | WB-STRAIN:WBStrain00031893 | WormBase (WB) | WB | available | PMID:37500635 | WB-STRAIN:RB1192, CGC_RB1192 | 2026-09-12 11:16:32 | 1 | ||
|
RB1190 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031891 | Caenorhabditis elegans | amx-2(ok1235) I. | B0019.1 Homozygous. Outer Left Sequence: ttggcggaaatttgaaagtc. Outer Right Sequence: tccaacggacacccaattat. Inner Left Sequence: cagcctcaaccaccttttgt. Inner Right Sequence: tctcagcaaatggacactgc. Inner Primer PCR Length: 2803. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000138(amx-2) | WBGene00000138(amx-2) | WB-STRAIN:WBStrain00031891 | WormBase (WB) | WB | available | PMID:37188705 | WB-STRAIN:RB1190, CGC_RB1190 | 2026-09-12 11:16:32 | 2 | ||
|
RB1189 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031890 | Caenorhabditis elegans | chs-1(ok1120) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00000496(chs-1) | WBGene00000254(bli-4), WBGene00000496(chs-1) | WB-STRAIN:WBStrain00031890 | WormBase (WB) | WB | available | WB-STRAIN:RB1189, CGC_RB1189 | 2026-09-12 11:16:32 | 1 | |||
|
RB1110 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031814 | Caenorhabditis elegans | C17E4.9(ok1089) I. | C17E4.9 Homozygous. Outer Left Sequence: AAAATTTGCCCTCCTTCCAT. Outer Right Sequence: CTCATCCACACCGAAAACCT. Inner Left Sequence: CAAACTTCCCCCTCTTCCTC. Inner Right Sequence: ATGAGAAGAGACCTGCCTCG. Inner Primer PCR Length: 2190. Estimated Deletion Size: about 1100 bp.|"Made_by: OMRK Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007646(nkb-1) | WBGene00007646(nkb-1) | WB-STRAIN:WBStrain00031814 | WormBase (WB) | WB | available | WB-STRAIN:RB1110, CGC_RB1110 | 2026-09-12 11:16:31 | 0 | |||
|
RB1107 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031811 | Caenorhabditis elegans | haf-3(ok1086) V. | F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001813(haf-3) | WBGene00001813(haf-3) | WB-STRAIN:WBStrain00031811 | WormBase (WB) | WB | available | WB-STRAIN:RB1107, CGC_RB1107 | 2026-09-12 11:16:31 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
