Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031795
Source Database: WormBase (WB)
Affected Genes: WBGene00013416(Y64G10A.7)
Genomic Alteration: WBGene00013416(Y64G10A.7)
Availability: available
Source References: EMPTY
Synonyms: Y64G10A.7(ok1062) IV.
Alternate IDs: WB-STRAIN:RB1091, CGC_RB1091
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y64G10A.7 Homozygous. Outer Left Sequence: AAAGACCGGACCACTTTGTG. Outer Right Sequence: AACTCACGTTGGACCGAATC. Inner Left Sequence: GTGCGCACACTTGTTCTTGT. Inner Right Sequence: CGATTGACATGCAATTTTCG. Inner Primer PCR Length: 3287. Estimated Deletion Size: about 2700 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00031795 Copy
http://www.wormbase.org/db/get?name=WBStrain00031793
Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)
Genomic Alteration: WBGene00001995(hpl-1)
Availability: available
Source References: EMPTY
Synonyms: hpl-1(ok1060) X.
Alternate IDs: WB-STRAIN:RB1089, CGC_RB1089
Notes: K08H2.6 Homozygous. Outer Left Sequence: CCGACATAGGTTTGCACCTT. Outer Right Sequence: CGAAGTGGAATTGGTGGTCT. Inner Left Sequence: CAAGATGCTCCGTTGTTTCA. Inner Right Sequence: GGAGTCGGGAATCAGTCAGA. Inner Primer PCR Length: 2728. Upper breakpoint flanking sequence: TTCGGATTTGAAAGAGTCTGAAAAAGAT. Lower breakpoint flanking sequence: TTGAACTGTAGTCTTTGCTACTTCTT. Deletion Size: 1948 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031793 Copy
http://www.wormbase.org/db/get?name=WBStrain00031715
Source Database: WormBase (WB)
Affected Genes: WBGene00007425(cht-5)
Genomic Alteration: WBGene00007425(cht-5)
Availability: available
Source References: EMPTY
Synonyms: C08B6.4(ok890) V.
Alternate IDs: WB-STRAIN:RB1006, CGC_RB1006
Notes: C08B6.4. Homozygous. Outer Left Sequence: AACACAACGAGGGACCTGAC. Outer Right Sequence: TGAACGCATCTGGATCATGT. Inner Left Sequence: GAGTCGGGGAAAAAGGGATA. Inner Right Sequence: GGTCGACCTAATGGAGACCA. Inner Primer WT PCR product: 2177. Deletion size: 1624 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031715 Copy
http://www.wormbase.org/db/get?name=WBStrain00031713
Source Database: WormBase (WB)
Affected Genes: WBGene00010664(dbn-1)
Genomic Alteration: WBGene00010664(dbn-1)
Availability: available
Source References: EMPTY
Synonyms: K08E3.4(ok925).
Alternate IDs: WB-STRAIN:RB1004, CGC_RB1004
Notes: K08E3.4. Homozygous. Outer Left Sequence: GGATGGACTCGAACCAAAAA. Outer Right Sequence: TTCTGGAGGGTCTCTGCCTA. Inner Left Sequence: TTGCAGGAAACACAACGAAG. Inner Right Sequence: CAAATTTGCCATATGTTGCG. Inner Primer WT PCR product: 2983. Deletion size: 1146 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031713 Copy
http://www.wormbase.org/db/get?name=WBStrain00031711
Source Database: WormBase (WB)
Affected Genes: WBGene00020567(adt-3)
Genomic Alteration: WBGene00020567(adt-3)
Availability: available
Source References: EMPTY
Synonyms: T19D2.1(ok923) X.
Alternate IDs: WB-STRAIN:RB1002, CGC_RB1002
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T19D2.1. Homozygous. Outer Left Sequence: GAGGAAATCGCGATGAAGAG. Outer Right Sequence: TCTCCGCAGTTTACAGAGCA. Inner Left Sequence: AGAGTTGGCTGTATTTGCGG. Inner Right Sequence: CGGCACATTCTGAAAGTCAA. Inner Primer WT PCR Product: 3298. Deletion size: 1666 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031711 Copy
http://www.wormbase.org/db/get?name=WBStrain00031799
Source Database: WormBase (WB)
Affected Genes: WBGene00006477(chup-1)
Genomic Alteration: WBGene00006477(chup-1)
Availability: available
Source References: EMPTY
Synonyms: chup-1(ok1073) X.
Alternate IDs: WB-STRAIN:RB1095, CGC_RB1095
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK721.1 Homozygous. Outer Left Sequence: AATTTCAGGCGCTATGAGGA. Outer Right Sequence: CTTGAAATAAAAGCGCGAGG. Inner Left Sequence: TGGGATGTGGTGTACGAAAA. Inner Right Sequence: CAGGAAATGACAGCAGCAAA. Inner Primer PCR Length: 2993. Estimated Deletion Size: about 1000 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00031799 Copy
http://www.wormbase.org/db/get?name=WBStrain00031710
Source Database: WormBase (WB)
Affected Genes: WBGene00007221(cpna-3)
Genomic Alteration: WBGene00007221(cpna-3)
Availability: available
Source References: EMPTY
Synonyms: C01F6.1(ok922) IV.
Alternate IDs: WB-STRAIN:RB1001, CGC_RB1001
Notes: C01F6.1 Homozygous. Outer Left Sequence: GGTTTTAGGAAACGGCATCA. Outer Right Sequence: AGCGTTACGAATTTTGGCAC. Inner Left Sequence: CTAGCAGGAGTGGTCTTGCC. Inner Right Sequence: GGATCAAAATGGAACATCCG. Inner Primer WT PCR Product: 2438. Deletion size: 1583 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031710 Copy
http://www.wormbase.org/db/get?name=WBStrain00031797
Source Database: WormBase (WB)
Affected Genes: WBGene00007463(vgln-1)
Genomic Alteration: WBGene00007463(vgln-1)
Availability: available
Source References: EMPTY
Synonyms: C08H9.2(ok1071) II.
Alternate IDs: WB-STRAIN:RB1093, CGC_RB1093
Notes: C08H9.2 Homozygous. Outer Left Sequence: CATCTTTTCCTGCAACGACA. Outer Right Sequence: AACATCACTTTCCGTTTGGC. Inner Left Sequence: GGATCTTCTGCTCCTTGACG. Inner Right Sequence: GGACGTCTCATTGGAAAGGA. Inner Primer PCR Length: 3020. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031797 Copy
http://www.wormbase.org/db/get?name=WBStrain00031718
Source Database: WormBase (WB)
Affected Genes: WBGene00012995(top-3B)
Genomic Alteration: WBGene00012995(top-3B)
Availability: available
Source References: EMPTY
Synonyms: Y48C3A.14(ok929) II.
Alternate IDs: WB-STRAIN:RB1009, CGC_RB1009
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48C3A.14 [Merged Y48C3A.15 in to this gene based on BLASTX homologies.] Homozygous. Outer Left Sequence: GACACCCTTGGTGTTCAGGT. Outer Right Sequence: ATCACTTTTCCTCGGGGAGT. Inner Left Sequence: TTGTGGCGACTCTGATGAAG. Inner Right Sequence: ACGAACATTTGAATTTCCCG. Inner Primer WT PCR Product: 2998. Deletion size: 2275 bp; includes insertion of approximately 1150 bp at break."
Proper citation: RRID:WB-STRAIN:WBStrain00031718 Copy
http://www.wormbase.org/db/get?name=WBStrain00031883
Source Database: WormBase (WB)
Affected Genes: WBGene00006528(tba-1)
Genomic Alteration: WBGene00006528(tba-1)
Availability: available
Source References: EMPTY
Synonyms: tba-1(ok1123) I.
Alternate IDs: WB-STRAIN:RB1182, CGC_RB1182
Notes: F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence:cagcccgactttcatttctc . Inner Primer PCR Length: 2176. Estimated Deletion Size: about 1100 bp. Received new stock 11/04/04.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031883 Copy
http://www.wormbase.org/db/get?name=WBStrain00031880
Source Database: WormBase (WB)
Affected Genes: WBGene00016948(scrt-1)
Genomic Alteration: WBGene00016948(scrt-1)
Availability: available
Source References: EMPTY
Synonyms: C55C2.1(ok1228) I.
Alternate IDs: WB-STRAIN:RB1179, CGC_RB1179
Notes: C55C2.1 Homozygous. Outer Left Sequence: gtcccatatgcttcttccca. Outer Right Sequence: aatccaagattcaaggcacg. Inner Left Sequence: tgtgaattgggtgagagcag. Inner Right Sequence: ttggcgtttttgtgtctctg. Inner Primer PCR Length: 2206. Estimated Deletion Size: about 1100 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031880 Copy
http://www.wormbase.org/db/get?name=WBStrain00031888
Source Database: WormBase (WB)
Affected Genes: WBGene00006560(tbx-41)
Genomic Alteration: WBGene00006560(tbx-41)
Availability: available
Source References: EMPTY
Synonyms: tbx-41(ok1231) X.
Alternate IDs: WB-STRAIN:RB1187, CGC_RB1187
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T26C11.1 Homozygous. Outer Left Sequence: ttcaaatgcattgccaaaaa. Outer Right Sequence: ttggcaacaacaaagcagag. Inner Left Sequence: cctccgaattttcccatttt. Inner Right Sequence: aaagctgaaggatctgccaa. Inner Primer PCR Length: 2932. Estimated Deletion Size: about 900 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031888 Copy
http://www.wormbase.org/db/get?name=WBStrain00031886
Source Database: WormBase (WB)
Affected Genes: WBGene00006528(tba-1)
Genomic Alteration: WBGene00006528(tba-1)
Availability: available
Source References: EMPTY
Synonyms: tba-1(ok1135) I.
Alternate IDs: WB-STRAIN:RB1185, CGC_RB1185
Notes: F26E4.8 Homozygous. Outer Left Sequence: gggcacttgaagttgatggt. Outer Right Sequence: cctttcctcgcaccagaata. Inner Left Sequence: tcgggaagttaagcgtcatt. Inner Right Sequence: cagcccgactttcatttctc. Inner Primer PCR Length: 2176. Estimated Deletion Size: about 900 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031886 Copy
http://www.wormbase.org/db/get?name=WBStrain00031805
Source Database: WormBase (WB)
Affected Genes: WBGene00007054(scpl-1)
Genomic Alteration: WBGene00007054(scpl-1)
Availability: available
Source References: EMPTY
Synonyms: scpl-1(ok1080) I.
Alternate IDs: WB-STRAIN:RB1101, CGC_RB1101
Notes: B0379.4 Homozygous. Outer Left Sequence: GAAGAACCGGGAGTCAACTG. Outer Right Sequence: AATTTTGAGGGCAGCTACGA. Inner Left Sequence: TTGAAAATTGGAACGAAGGC. Inner Right Sequence: AAGTATGCGGGAACCACAAC. Inner Primer PCR Length: 2908. Estimated Deletion Size: about 900 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031805 Copy
http://www.wormbase.org/db/get?name=WBStrain00031894
Source Database: WormBase (WB)
Affected Genes: WBGene00009686(ent-7)
Genomic Alteration: WBGene00009686(ent-7)
Availability: available
Source References: EMPTY
Synonyms: F44D12.9(ok1238) IV.
Alternate IDs: WB-STRAIN:RB1193, CGC_RB1193
Notes: F44D12.9 Homozygous. Outer Left Sequence: AGCCAAGATTTGGGCCTACT. Outer Right Sequence: TGCACCATATCCGTGTGACT. Inner Left Sequence: ACATGCTTGTTTTTGGGGAA. Inner Right Sequence: AATGGGTGTACTGGCGACTC. Inner Primer PCR Length: 2230. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031894 Copy
http://www.wormbase.org/db/get?name=WBStrain00031893
Source Database: WormBase (WB)
Affected Genes: WBGene00016066(acd-2)
Genomic Alteration: WBGene00016066(acd-2)
Availability: available
Source References: PMID:37500635
Synonyms: C24G7.4(ok1237) I.
Alternate IDs: WB-STRAIN:RB1192, CGC_RB1192
Notes: C24G7.4 Homozygous. Outer Left Sequence: ccctttttgacgtgcattct. Outer Right Sequence: ggagcccataaacaccaaaa. Inner Left Sequence: acaagcagtttgccaatcaa. Inner Right Sequence: ttgttttgaagcgaaaaccc. Inner Primer PCR Length: 3185. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031893 Copy
http://www.wormbase.org/db/get?name=WBStrain00031891
Source Database: WormBase (WB)
Affected Genes: WBGene00000138(amx-2)
Genomic Alteration: WBGene00000138(amx-2)
Availability: available
Source References: PMID:37188705
Synonyms: amx-2(ok1235) I.
Alternate IDs: WB-STRAIN:RB1190, CGC_RB1190
Notes: B0019.1 Homozygous. Outer Left Sequence: ttggcggaaatttgaaagtc. Outer Right Sequence: tccaacggacacccaattat. Inner Left Sequence: cagcctcaaccaccttttgt. Inner Right Sequence: tctcagcaaatggacactgc. Inner Primer PCR Length: 2803. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031891 Copy
http://www.wormbase.org/db/get?name=WBStrain00031890
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00000496(chs-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00000496(chs-1)
Availability: available
Source References: EMPTY
Synonyms: chs-1(ok1120) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:RB1189, CGC_RB1189
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T25G3.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Segregates very rare homozygous hT2 glowing animals. Outer Left Sequence: tgtggctgtgttgcaaagat. Outer Right Sequence: tggagaagcattccgagagt. Inner Left Sequence: atttgcacttcagctggctt. Inner Right Sequence: ggttcatcggtttcctcgta. Inner Primer PCR Length: 3205. Estimated Deletion Size: about 1600 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031890 Copy
http://www.wormbase.org/db/get?name=WBStrain00031814
Source Database: WormBase (WB)
Affected Genes: WBGene00007646(nkb-1)
Genomic Alteration: WBGene00007646(nkb-1)
Availability: available
Source References: EMPTY
Synonyms: C17E4.9(ok1089) I.
Alternate IDs: WB-STRAIN:RB1110, CGC_RB1110
Notes: C17E4.9 Homozygous. Outer Left Sequence: AAAATTTGCCCTCCTTCCAT. Outer Right Sequence: CTCATCCACACCGAAAACCT. Inner Left Sequence: CAAACTTCCCCCTCTTCCTC. Inner Right Sequence: ATGAGAAGAGACCTGCCTCG. Inner Primer PCR Length: 2190. Estimated Deletion Size: about 1100 bp.|"Made_by: OMRK Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031814 Copy
http://www.wormbase.org/db/get?name=WBStrain00031811
Source Database: WormBase (WB)
Affected Genes: WBGene00001813(haf-3)
Genomic Alteration: WBGene00001813(haf-3)
Availability: available
Source References: EMPTY
Synonyms: haf-3(ok1086) V.
Alternate IDs: WB-STRAIN:RB1107, CGC_RB1107
Notes: F57A10.3. Homozygous. Outer Left Sequence: TTTCGGAAATTTTATTGCGG. Outer Right Sequence: CCGTGCATTGATCACTTGTT. Inner Left Sequence: TTTGCATTCCTTCCAAATCC. Inner Right Sequence: TTGAAAACCCTCCTCGTGTC. Inner Primer PCR Length: 2930 bp. Deletion Size: 1150 bp. Deletion left flank: GTGTTTCAGGGAAAAAAATCTACAAAATTT. Deletion right flank: TATTTTTGAAGAAATTTTCTTAATTTTTGT.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00031811 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.