Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 137 showing 2721 ~ 2740 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00032619

http://www.wormbase.org/db/get?name=WBStrain00032619

Source Database: WormBase (WB)
Affected Genes: WBGene00021072(W07B8.4)
Genomic Alteration: WBGene00021072(W07B8.4)
Availability: available
Source References: EMPTY
Synonyms: W07B8.4(ok2537) V.
Alternate IDs: WB-STRAIN:RB1934, CGC_RB1934
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07B8.4 Homozygous. Outer Left Sequence: caatggggtttcaaagcaat. Outer Right Sequence: gccgattttcagttagcctg. Inner Left Sequence: catgtattcctcgggattcg. Inner Right Sequence: ttcgctctgattcacttcca. Inner Primer PCR Length: 3069. Deletion size: about 1400 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00032619 Copy   


  • RRID:WB-STRAIN:WBStrain00032626

http://www.wormbase.org/db/get?name=WBStrain00032626

Source Database: WormBase (WB)
Affected Genes: WBGene00004319(rbr-2)
Genomic Alteration: WBGene00004319(rbr-2)
Availability: available
Source References: EMPTY
Synonyms: rbr-2(ok2544) IV.
Alternate IDs: WB-STRAIN:RB1941, CGC_RB1941
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK593.4. Homozygous. Outer Left Sequence: GAGGGGAAGATGAGTGTCCA. Outer Right Sequence: GCATGTCAGTGTTGATTCGG. Inner Left Sequence: TGCGTTGCTTGTAATGAAGG. Inner Right Sequence: TGAGCATGCTTCAAGACCAC. Inner Primer PCR Length: 3298 bp. Deletion Size: 1311 bp. Deletion left flank: CGAGTCGAGTAGGAAGTGGATTTCCTCGAA. Deletion right flank: GAGCAAAAGATGCTATCTATCGAGAACAAG."

Proper citation: RRID:WB-STRAIN:WBStrain00032626 Copy   


  • RRID:WB-STRAIN:WBStrain00032624

http://www.wormbase.org/db/get?name=WBStrain00032624

Source Database: WormBase (WB)
Affected Genes: WBGene00016796(cec-2)
Genomic Alteration: WBGene00016796(cec-2)
Availability: available
Source References: EMPTY
Synonyms: C50A2.2(ok2542) IV.
Alternate IDs: WB-STRAIN:RB1939, CGC_RB1939
Notes: C50A2.2. Homozygous. Outer Left Sequence: AAAATCGTCGTCGAAACCTG. Outer Right Sequence: CTGACGCAAAATTGCAGAAA. Inner Left Sequence: ACAACGAACCGAGCCGAT. Inner Right Sequence: GTGCGTATTGGGAAGGTAGC. Inner Primer PCR Length: 3005 bp. Deletion Size: 1982 bp. Deletion left flank: ATTTAGTGTGACTAGGTTACTGTAGCACCA. Deletion right flank: CGTCAGATTGTGTTTACCAACAAAAAAAAT. Insertion Sequence: GACTTTTTTCTGCAATTTTG.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032624 Copy   


  • RRID:WB-STRAIN:WBStrain00032621

http://www.wormbase.org/db/get?name=WBStrain00032621

Source Database: WormBase (WB)
Affected Genes: WBGene00010895(M28.4)
Genomic Alteration: WBGene00010895(M28.4)
Availability: available
Source References: EMPTY
Synonyms: M28.4(ok2539) II.
Alternate IDs: WB-STRAIN:RB1936, CGC_RB1936
Notes: M28.4 Homozygous. Outer Left Sequence: agcgattccaaaatcactgg. Outer Right Sequence: tgcctggtaggcagaaaagt. Inner Left Sequence: cgctggattgttggttatca. Inner Right Sequence: gtcattggaattggaggtgg. Inner Primer PCR Length: 3023. Deletion size: about 2000 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032621 Copy   


  • RRID:WB-STRAIN:WBStrain00032629

http://www.wormbase.org/db/get?name=WBStrain00032629

Source Database: WormBase (WB)
Affected Genes: WBGene00010805(M01E5.2)
Genomic Alteration: WBGene00010805(M01E5.2)
Availability: available
Source References: EMPTY
Synonyms: M01E5.2(ok2552) I.
Alternate IDs: WB-STRAIN:RB1944, CGC_RB1944
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAA AATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAA AAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT."|"ok2552. Homozygous. Outer Left Sequence: CAAAGATTGTGGCGGAAAAT. Outer Right Sequence: CGGTAGCTGATTTTCGTGGT. Inner Left Sequence: GTTACACCTTTTCCTGGCGA. Inner Right Sequence: CTAAAATTCTGCGGAAACCG. Inner Primer PCR Length: 2997 bp. Deletion Size: 2279 bp. Deletion left flank: ATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTACACGAAAAAATAGATTGTTAC. Deletion right flank: CAAAAAACTGTGAAAATTCACTTCAACTGT."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032629 Copy   


  • RRID:WB-STRAIN:WBStrain00032674

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00032674

Source Database: WormBase (WB)
Affected Genes: WBGene00001450(flp-7)
Genomic Alteration: WBGene00001450(flp-7)
Availability: available
Source References: EMPTY
Synonyms: flp-7(ok2625) X.
Alternate IDs: WB-STRAIN:RB1990, CGC_RB1990
Notes: F49E10.3. Homozygous. Outer Left Sequence: GAAGGCGGAGTCATAGCATC. Outer Right Sequence: TGAAGGACTGGAAAACAGGC. Inner Left Sequence: ATGAGAAGAAGGGGGTGGAG. Inner Right Sequence: TTGGGTAGCGACCAATCTGT. Inner Primer PCR Length: 1302 bp. Deletion Size: 548 bp. Deletion left flank: TCCTATTTTTTCTATTTTTTATATTTTTCA. Deletion right flank: TGCAAACACCTTGATTACCAAGAACAAAAC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032674 Copy   


  • RRID:WB-STRAIN:WBStrain00032673

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00032673

Source Database: WormBase (WB)
Affected Genes: WBGene00001453(flp-10)
Genomic Alteration: WBGene00001453(flp-10)
Availability: available
Source References: PMID:37769660
Synonyms: flp-10(ok2624) IV.
Alternate IDs: WB-STRAIN:RB1989, CGC_RB1989
Notes: Made_by: OMRF Knockout Group|"Supplementary_genotype flp-10(ok2624)"|"T06C10.4. Homozygous. Outer Left Sequence: CCTATGATCCAAGCCCTCAA. Outer Right Sequence: AAAACTTGACGACTGGTGGG. Inner Left Sequence: TCCAATTAACGTTTATGACCGA. Inner Right Sequence: GCATGATGACGTGGATTTTG. Inner Primer PCR Length: 1168 bp. Deletion Size: 682 bp. Deletion left flank: CCCATCTCACTAATTATACGCCTAAATCTT. Deletion right flank: ACATTCGATTCGGAAAACGAAGAGTCGATC."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032673 Copy   


  • RRID:WB-STRAIN:WBStrain00032670

http://www.wormbase.org/db/get?name=WBStrain00032670

Source Database: WormBase (WB)
Affected Genes: WBGene00013739(spin-4)
Genomic Alteration: WBGene00013739(spin-4)
Availability: available
Source References: EMPTY
Synonyms: Y111B2A.19(ok2620) III.
Alternate IDs: WB-STRAIN:RB1986, CGC_RB1986
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y111B2A.19 Homozygous. Outer Left Sequence: attttcggtaatttgccggt. Outer Right Sequence: aaaattacgctccgcctctt. Inner Left Sequence: tctgccagtttgctggaaat. Inner Right Sequence: tgcgcgacgctacttataga. Inner Primer PCR Length: 3222. Deletion size: about 1700 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00032670 Copy   


  • RRID:WB-STRAIN:WBStrain00032679

http://www.wormbase.org/db/get?name=WBStrain00032679

Source Database: WormBase (WB)
Affected Genes: WBGene00009409(F35E2.1)
Genomic Alteration: WBGene00009409(F35E2.1)
Availability: available
Source References: EMPTY
Synonyms: F35E2.1(ok2630) I.
Alternate IDs: WB-STRAIN:RB1995, CGC_RB1995
Notes: F35E2.1. Homozygous. Outer Left Sequence: TGCGGATCTTGTTGTCTGAG. Outer Right Sequence: ATGGAACTTGTTCGGGTGAG. Inner Left Sequence: AAGGCGTATGTCCGAAGATG. Inner Right Sequence: CAATTGATTTGTAGACTGATTGGAA. Inner Primer PCR Length: 1374 bp. Deletion Size: 311 bp. Deletion left flank: ACTCTCTCATAGTTTATAGTGTGGGAAAGT. Deletion right flank: TTTGGGAAACATCCACATAAAGCTGTATCC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032679 Copy   


  • RRID:WB-STRAIN:WBStrain00032677

http://www.wormbase.org/db/get?name=WBStrain00032677

Source Database: WormBase (WB)
Affected Genes: WBGene00007362(cyp-35C1)
Genomic Alteration: WBGene00007362(cyp-35C1)
Availability: available
Source References: PMID:31898444
Synonyms: C06B3.3(ok2628) V.
Alternate IDs: WB-STRAIN:RB1993, CGC_RB1993
Notes: C06B3.3 Homozygous. Outer Left Sequence: ggcaaagatcacaattccgt. Outer Right Sequence: tgggaatgggaagagatttg. Inner Left Sequence: aaggcttcgcatctcttgg. Inner Right Sequence: tgcaaggtaccattaaccga. Inner Primer PCR Length: 1208. Deletion size: about 700 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032677 Copy   


  • RRID:WB-STRAIN:WBStrain00032686

http://www.wormbase.org/db/get?name=WBStrain00032686

Source Database: WormBase (WB)
Affected Genes: WBGene00009618(F41E7.2)
Genomic Alteration: WBGene00009618(F41E7.2)
Availability: available
Source References: PMID:38302462
Synonyms: F41E7.2(ok2647) X.
Alternate IDs: WB-STRAIN:RB2002, CGC_RB2002
Notes: F41E7.2 Homozygous. Outer Left Sequence: aatgccaactatgattcgcc. Outer Right Sequence: tctcgcggatacaaagacct. Inner Left Sequence: aagaacagggaatcggaacc. Inner Right Sequence: ttctctcctcgttccacctc. Inner Primer PCR Length: 3078. Deletion size: about 1500 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032686 Copy   


  • RRID:WB-STRAIN:WBStrain00032685

http://www.wormbase.org/db/get?name=WBStrain00032685

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: F52E10.3(ok2646) X.
Alternate IDs: WB-STRAIN:RB2001, CGC_RB2001
Notes: F52E10.3. Homozygous. Outer Left Sequence: TCGGACTCCTGTTCGCTAGT. Outer Right Sequence: TGGCAGTTTCTCTTCTCCGT. Inner Left Sequence: CAACGGGCATCTTTGTAATCT. Inner Right Sequence: GGATTTATGGCTCTCACCCA. Inner Primer PCR Length: 1229 bp. Deletion Size: 533 bp. Deletion left flank: GTGGAAATTCGTTTTCAGTAGGGCGTATTT. Deletion right flank: TAATATTTTTAAATTCAAGTTATAAGCATT. Insertion Sequence: TT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032685 Copy   


  • RRID:WB-STRAIN:WBStrain00032684

http://www.wormbase.org/db/get?name=WBStrain00032684

Source Database: WormBase (WB)
Affected Genes: WBGene00017123(maoc-1)|WBGene00017126(E04F6.6)
Genomic Alteration: WBGene00017123(maoc-1), WBGene00017126(E04F6.6)
Availability: available
Source References: EMPTY
Synonyms: maoc-1&E04F6.6(ok2645) II.
Alternate IDs: WB-STRAIN:RB2000, CGC_RB2000
Notes: E04F6.3, E04F6.6. Homozygous. Outer Left Sequence: AACGATGGAGAGGAAACGTG. Outer Right Sequence: TGAACCACGTCCAGAAGATG. Inner Left Sequence: GGACGGTCATTGTTATCTCTTG. Inner Right Sequence: CGGTGGGAATAAGACAGAGG. Inner Primer PCR Length: 3145 bp. Deletion Size: 2110 bp. Deletion left flank: ATACTTTTTTTGCAAATTATTTAAAACATC. Deletion right flank: AGTAAAACCATTCAAATATAATATAAATTC. Insertion Sequence: AGTAAAAACGTC.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032684 Copy   


  • RRID:WB-STRAIN:WBStrain00032683

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00032683

Source Database: WormBase (WB)
Affected Genes: WBGene00001716(grl-7)
Genomic Alteration: WBGene00001716(grl-7)
Availability: available
Source References: EMPTY
Synonyms: grl-7(ok2644) V.
Alternate IDs: WB-STRAIN:RB1999, CGC_RB1999
Notes: Made_by: OMRF Knockout Group|"T02E9.2. Homozygous. Outer Left Sequence: AGACCCTCCGTACCTGGTTT. Outer Right Sequence: CTTTGAATGGCAGTGTGACG. Inner Left Sequence: AAGCTCGGAAGCGTGCTG. Inner Right Sequence: CTATTGCATAACCGCCCATC. Inner Primer PCR Length: 1207 bp. Deletion Size: 424 bp. Deletion left flank: CGATTCCTGAGCTGTAGCAACTTCCGCGAC. Deletion right flank: CGGAATAGCATTCTGGAAATAGAATCAACA."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032683 Copy   


  • RRID:WB-STRAIN:WBStrain00032682

http://www.wormbase.org/db/get?name=WBStrain00032682

Source Database: WormBase (WB)
Affected Genes: WBGene00001984(hog-1)
Genomic Alteration: WBGene00001984(hog-1)
Availability: available
Source References: EMPTY
Synonyms: hog-1(ok2643) X.
Alternate IDs: WB-STRAIN:RB1998, CGC_RB1998
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W06B11.4. Homozygous. Outer Left Sequence: TGAAGCTAATGCTGAACCGA. Outer Right Sequence: CAGTACAAACGGCTGCACAT. Inner Left Sequence: TTGTGGCCTAAAATGCAAAA. Inner Right Sequence: TCATGCTTGTTTTTCTACCGA. Inner Primer PCR Length: 1280 bp. Deletion Size: 487 bp. Deletion left flank: GTAGTTTTCTAAAATTTTATTGTTAACAGT. Deletion right flank: AGATAAGATGTTTTGCAGATACAGCGAGCA."

Proper citation: RRID:WB-STRAIN:WBStrain00032682 Copy   


  • RRID:WB-STRAIN:WBStrain00032681

http://www.wormbase.org/db/get?name=WBStrain00032681

Source Database: WormBase (WB)
Affected Genes: WBGene00012342(mtr-4)
Genomic Alteration: WBGene00012342(mtr-4)
Availability: available
Source References: EMPTY
Synonyms: mtr-4(ok2642) IV.
Alternate IDs: WB-STRAIN:RB1997, CGC_RB1997
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W08D2.7. Homozygous. Outer Left Sequence: CAGCTCACACATCTGCTGGT. Outer Right Sequence: AGAGCATCATCGTTTCCCAG. Inner Left Sequence: CGTCTCCAATCAAAGCACTG. Inner Right Sequence: CACTTTTTCTTTCGGCTTTCA. Inner Primer PCR Length: 3060 bp. Deletion Size: 1554 bp. Deletion left flank: CTTAAAATATTTTTAACTTCAGAATGGGTC. Deletion right flank: AAAGAATTATTCAAATTCAACGAGAACCCA."

Proper citation: RRID:WB-STRAIN:WBStrain00032681 Copy   


  • RRID:WB-STRAIN:WBStrain00032606

http://www.wormbase.org/db/get?name=WBStrain00032606

Source Database: WormBase (WB)
Affected Genes: WBGene00000522(clc-1)
Genomic Alteration: WBGene00000522(clc-1)
Availability: available
Source References: EMPTY
Synonyms: clc-1(ok2500) X.
Alternate IDs: WB-STRAIN:RB1921, CGC_RB1921
Notes: C09F12.1 Homozygous. Outer Left Sequence: gcacgttgccattccttatt. Outer Right Sequence: catccccgagaggtccttat. Inner Left Sequence: ttgcatagatgccaccatgt. Inner Right Sequence: atctttaacccatccgcctt. Inner Primer PCR Length: 2240. Deletion size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"no longer available from the CGC"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032606 Copy   


  • RRID:WB-STRAIN:WBStrain00032603

http://www.wormbase.org/db/get?name=WBStrain00032603

Source Database: WormBase (WB)
Affected Genes: WBGene00021046(sedl-1)
Genomic Alteration: WBGene00021046(sedl-1)
Availability: available
Source References: EMPTY
Synonyms: sedl-1(ok2497) X.
Alternate IDs: WB-STRAIN:RB1918, CGC_RB1918
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W05H7.3. Homozygous. Outer Left Sequence: CTTTTCAACCGGTTTTGCAT. Outer Right Sequence: CGACTAAGAGAGCCCGTGTC. Inner Left Sequence: TTCCTGTGAGAAAAATCCCG. Inner Right Sequence: GATGAGCCAAGCTTAGTGGC. Inner Primer PCR Length: 2915 bp. Deletion Size: 1236 bp. Deletion left flank: AAACTAAATTCAGAAAATATTTTTGGCTTC. Deletion right flank: TATTCAGAAATCAACTGGGCTGATGATACC."

Proper citation: RRID:WB-STRAIN:WBStrain00032603 Copy   


  • RRID:WB-STRAIN:WBStrain00032609

http://www.wormbase.org/db/get?name=WBStrain00032609

Source Database: WormBase (WB)
Affected Genes: WBGene00009741(drr-1)
Genomic Alteration: WBGene00009741(drr-1)
Availability: available
Source References: EMPTY
Synonyms: F45H10.4(ok2503) II.
Alternate IDs: WB-STRAIN:RB1924, CGC_RB1924
Notes: F45H10.4 Homozygous. Outer Left Sequence: aacgaacgagttcaattggc. Outer Right Sequence: ggccaccgatttttcctatt. Inner Left Sequence: taaagcaatttccccacagg. Inner Right Sequence: ttacggccacatagcaaaaa. Inner Primer PCR Length: 3175. Deletion size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00032609 Copy   


  • RRID:WB-STRAIN:WBStrain00032608

http://www.wormbase.org/db/get?name=WBStrain00032608

Source Database: WormBase (WB)
Affected Genes: WBGene00020712(ckr-1)
Genomic Alteration: WBGene00020712(ckr-1)
Availability: available
Source References: PMID:33524034
Synonyms: ckr-1(ok2502) I.
Alternate IDs: WB-STRAIN:RB1923, CGC_RB1923
Notes: Made_by: OMRF Knockout Group|"T23B3.4. Homozygous. Outer Left Sequence: TTTCAAAAACCCTGGTACGG. Outer Right Sequence: AAATCGCCATTGAAATACGC. Inner Left Sequence: TGAGTTGGAGATGAAGGGCT. Inner Right Sequence: GATCCTCACAATCCTCGGAA. Inner Primer PCR Length: 2705 bp. Deletion Size: 1289 bp. Deletion left flank: CTTTGGAATTGGATGTCTAGTTTTTTTAGT. Deletion right flank: CAGTGGGGAGCTGAGATAAAAACAGAATTT."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060969 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00032608 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X