Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 131 showing 2601 ~ 2620 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00036431

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036431

Source Database: WormBase (WB)
Affected Genes: WBGene00002222(klp-11)
Genomic Alteration: WBGene00002222(klp-11)
Availability: available
Source References: PMID:37463209, PMID:38302462
Synonyms: klp-11(tm324) IV.
Alternate IDs: WB-STRAIN:VC1228, CGC_VC1228
Notes: 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036431 Copy   


  • RRID:WB-STRAIN:WBStrain00036433

http://www.wormbase.org/db/get?name=WBStrain00036433

Source Database: WormBase (WB)
Affected Genes: WBGene00008099(hzl-1)
Genomic Alteration: WBGene00008099(hzl-1)
Availability: available
Source References: EMPTY
Synonyms: C44H9.4(ok1688) V.
Alternate IDs: WB-STRAIN:VC1230, CGC_VC1230
Notes: C44H9.4. Superficially wild type. External left primer: GAACAGAATGCGTTCAGCAA. External right primer: AAATCAAAAGACCGGTTTCG. Internal left primer: CTCCAAAACCCCGTCAAGTA. Internal right primer: TTCGGTGTCCTCTTTGGTTT. Internal WT amplicon: 3088 bp. Deletion size: 737 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036433 Copy   


  • RRID:WB-STRAIN:WBStrain00036435

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036435

Source Database: WormBase (WB)
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
Source References: PMID:36652499
Synonyms: ocr-2(ok1711) IV.
Alternate IDs: WB-STRAIN:VC1233, CGC_VC1233
Notes: T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036435 Copy   


  • RRID:WB-STRAIN:WBStrain00036440

http://www.wormbase.org/db/get?name=WBStrain00036440

Source Database: WormBase (WB)
Affected Genes: WBGene00004807(skr-1)
Genomic Alteration: WBGene00004807(skr-1)
Availability: available
Source References: PMID:32857970, PMID:38458533
Synonyms: skr-1(ok1696) I.
Alternate IDs: WB-STRAIN:VC1241, CGC_VC1241
Notes: F46A9.5. Superficially wild type. External left primer: AATCCGTAAGGAAAACGCCT. External right primer: AGTGTTTTCGGAAATGGCAC. Internal left primer: CACTGCCAGCTGACACAACT. Internal right primer: CGCAGAATTTGAACACGTTG. Internal WT amplicon: 2194 bp. Deletion size: 1740 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060142 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00036440 Copy   


  • RRID:WB-STRAIN:WBStrain00036449

http://www.wormbase.org/db/get?name=WBStrain00036449

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003803(rae-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003803(rae-1)
Availability: available
Source References: EMPTY
Synonyms: rae-1(ok1720) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1251, CGC_VC1251
Notes: F10G8.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1720 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATACATTCGAACGCGACACA. External right primer: CCAGAAACGCGGTTTAACAT. Internal left primer: GCGCTCTACTGCCAATTTTC. Internal right primer: GGAAAGCACCCGAACTATGA. Internal WT amplicon: 2465 bp. Deletion size: approximately 750 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036449 Copy   


  • RRID:WB-STRAIN:WBStrain00036443

http://www.wormbase.org/db/get?name=WBStrain00036443

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00004873(smc-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00004873(smc-3)
Availability: available
Source References: EMPTY
Synonyms: smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1245, CGC_VC1245
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain."

Proper citation: RRID:WB-STRAIN:WBStrain00036443 Copy   


  • RRID:WB-STRAIN:WBStrain00036446

http://www.wormbase.org/db/get?name=WBStrain00036446

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00013552(gmn-1)|WBGene00013553(Y75B8A.18)
Genomic Alteration: WBGene00000254(bli-4), WBGene00013552(gmn-1), WBGene00013553(Y75B8A.18)
Availability: available
Source References: EMPTY
Synonyms: gmn-1&Y75B8A.18(ok1708) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1248, CGC_VC1248
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y75B8A.17, Y75B8A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1708 homozygotes (mostly sterile; occasional progeny arrest as larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACTTCGTTTCGAGCGTCCT. External right primer: AGTAGGCCGTCAAATTGGTG. Internal left primer: TCCGCCGTCTCTTCTATTGT. Internal right primer: AACAATCCTGTTCCGCTCAT. Internal WT amplicon: 2898 bp. Deletion size: 1490 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00036446 Copy   


  • RRID:WB-STRAIN:WBStrain00036448

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036448

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00021636(pcaf-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00021636(pcaf-1)
Availability: available
Source References: EMPTY
Synonyms: pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1250, CGC_VC1250
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT."

Proper citation: RRID:WB-STRAIN:WBStrain00036448 Copy   


  • RRID:WB-STRAIN:WBStrain00036447

http://www.wormbase.org/db/get?name=WBStrain00036447

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006735(ula-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006735(ula-1)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; ula-1(ok1700)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC1249, CGC_VC1249
Notes: C26E6.8. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1700 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGGTTTCCGGGGATATCTAA. External right primer: CGTACTGCCTGCATGAGAAA. Internal left primer: ATGTCATGCCACAAGGAACA. Internal right primer: CATTCTTGTGAAACTCGCCA. Internal WT amplicon: 2184 bp. Deletion size: 930 bp. Deletion left flank: GAATGTTGCCGACTCCTGAGTATGTCCATC. Deletion right flank: GAACGTCGGAAACTCATAAGAATCGCCTGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036447 Copy   


  • RRID:WB-STRAIN:WBStrain00036451

http://www.wormbase.org/db/get?name=WBStrain00036451

Source Database: WormBase (WB)
Affected Genes: WBGene00000787(cps-6)
Genomic Alteration: WBGene00000787(cps-6)
Availability: available
Source References: EMPTY
Synonyms: cps-6(ok1718) I.
Alternate IDs: WB-STRAIN:VC1253, CGC_VC1253
Notes: C41D11.8. Superficially wild type. External left primer: TCGTGTTTTTGTTTCCTCCC. External right primer: TTGTTCTGATCGCAGTTGGA. Internal left primer: CCTTTTCCACCTTCCCCTAT. Internal right primer: AAGCTTCGGGTGATTTCTGA. Internal WT amplicon: 2220 bp. Deletion size: 676 bp. Deletion left flank: CCTTCCCCTATTTCGGATGAATTTTTGTTG. Deletion right flank: AGTTACGTGTTTTTGCGAAAAACTTCGTCG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036451 Copy   


  • RRID:WB-STRAIN:WBStrain00036537

http://www.wormbase.org/db/get?name=WBStrain00036537

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: C17E7(gk600) V.
Alternate IDs: WB-STRAIN:VC1351, CGC_VC1351
Notes: C17E7. Superficially wild type. External left primer: TTGAGGACGGAGTTGCTCTT. External right primer: TCTCCACTGCTTGTTGATCG. Internal left primer: TCCAAATACCGTAGCCCATC. Internal right primer: TCCACCGTCTCTAAGCGAAT. Internal WT amplicon: 1642 bp. Deletion size: 608 bp. Deletion left flank: CGAGGACAACGTGAATATTGCAAAGAGCAA. Deletion right flank: TTTTGTGAGATAAATTGCCTCAACCCTGTA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036537 Copy   


  • RRID:WB-STRAIN:WBStrain00036530

http://www.wormbase.org/db/get?name=WBStrain00036530

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00020383(tin-44)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020383(tin-44)
Availability: available
Source References: EMPTY
Synonyms: T09B4.9(ok1792) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1344, CGC_VC1344
Notes: T09B4.9. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1792 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTTCAGGCATTATCCA. External right primer: TCAAAATTGCATCACTGGGA. Internal left primer: TCTTCGCTCCGAATTGAACT. Internal right primer: TTGTGGAAACGGGATACGAT. Internal WT amplicon: 2834 bp. Deletion size: 1635 bp. Deletion left flank: AAAAGTTGAGATTTAATTAGGACACTGAGA. Deletion right flank: TTCTCCAAATCGAACCCATCTGTCCGTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036530 Copy   


  • RRID:WB-STRAIN:WBStrain00036532

http://www.wormbase.org/db/get?name=WBStrain00036532

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: F59B2(ok1801) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1346, CGC_VC1346
Notes: F59B2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1801 homozygotes (sterile, Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGCTCAGCAAGAAAATGAG. External right primer: GTGCTCGATGTCCACACAAC. Internal left primer: ATACCGCCTGCAATTTTCTG. Internal right primer: GCTTTTGAAATCGAAGCGAC. Internal WT amplicon: 2606 bp. Deletion size: 829 bp. Deletion left flank: TTAACAAGAAAAAATGATTTTAAAACCGTG. Deletion right flank: AAAAATTAACATGTCGAGAACCTAAGTGTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036532 Copy   


  • RRID:WB-STRAIN:WBStrain00036534

http://www.wormbase.org/db/get?name=WBStrain00036534

Source Database: WormBase (WB)
Affected Genes: WBGene00001037(dnj-19)
Genomic Alteration: WBGene00001037(dnj-19)
Availability: available
Source References: EMPTY
Synonyms: dnj-19(gk649) V.
Alternate IDs: WB-STRAIN:VC1348, CGC_VC1348
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T05C3.5. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 931 bp. Deletion left flank: TAAGGAAATTATAGCCGCAAAGTGCCTCAT. Deletion right flank: CGGCCTGCGAAGCGTCTGGTCTCACATTGA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036534 Copy   


  • RRID:WB-STRAIN:WBStrain00036535

http://www.wormbase.org/db/get?name=WBStrain00036535

Source Database: WormBase (WB)
Affected Genes: WBGene00003637(nhr-47)
Genomic Alteration: WBGene00003637(nhr-47)
Availability: available
Source References: EMPTY
Synonyms: nhr-47(gk954) V.
Alternate IDs: WB-STRAIN:VC1349, CGC_VC1349
Notes: C24G6.4. Superficially wild type. External left primer: TTTGGCATTCCTTTTCCAAG. External right primer: CGGCCAAACATTTTTGAAGT. Internal left primer: TCCTCTGATGACTCCTGGCT. Internal right primer: CTTGACACACGAATTCTCGG. Internal WT amplicon: 2058 bp. Deletion size: 742 bp. Deletion left flank: TTAATAATTCAATAATGTAAATTATTGAAT. Deletion right flank: GTAAGATCAATTTAACAAGCATCAAACATC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036535 Copy   


  • RRID:WB-STRAIN:WBStrain00036549

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00036549

Source Database: WormBase (WB)
Affected Genes: WBGene00004466(rpn-10)
Genomic Alteration: WBGene00004466(rpn-10)
Availability: available
Source References: PMID:37355092
Synonyms: rpn-10(ok1865) I.
Alternate IDs: WB-STRAIN:VC1369, CGC_VC1369
Notes: B0205.3. Superficially wild type. External left primer: CTTTTTAAGCGGTGCGTCAT. External right primer: GCTCGATATTCCATCCGAAA. Internal left primer: TGGGTCTCTTCTCGCATCTC. Internal right primer: TGCACCAACAACTCCACATT. Internal WT amplicon: 2184 bp. Deletion size: 1166 bp. Deletion left flank: CAGAATCCGCGGCACCTCCATTTGCAGCAG. Deletion right flank: TATGAACTCTGTAGAATGTGAGAAATAAAA.|"Mutagen:UV/TMP"|"Supplementary_genotype (rpn-10(ok1865) I)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036549 Copy   


  • RRID:WB-STRAIN:WBStrain00036541

http://www.wormbase.org/db/get?name=WBStrain00036541

Source Database: WormBase (WB)
Affected Genes: WBGene00019154(glf-1)
Genomic Alteration: WBGene00019154(glf-1)
Availability: available
Source References: EMPTY
Synonyms: H04M03.4(ok1750)/nT1 IV; +/nT1 V.
Alternate IDs: WB-STRAIN:VC1357, CGC_VC1357
Notes: H04M03.4. Apparent homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1750 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ACGGAAATTGTGCCGTTAAT. External right primer: TTTTGCGAATTTTTCATCCC. Internal left primer: AATGTTTCAGGAGGCCATTG. Internal right primer: TATCCCCGTGGAATAGTTGG. Internal WT amplicon: 3042 bp. Deletion size: 1376 bp. Deletion left flank: AGAAGTTGCCAAATGAGTGGTTCAAGTTCA. Deletion right flank: TATATGTGCTATATAATTCTCATAATTTCC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036541 Copy   


  • RRID:WB-STRAIN:WBStrain00036540

http://www.wormbase.org/db/get?name=WBStrain00036540

Source Database: WormBase (WB)
Affected Genes: WBGene00011566(nhr-214)
Genomic Alteration: WBGene00011566(nhr-214)
Availability: available
Source References: EMPTY
Synonyms: nhr-214(gk604) X.
Alternate IDs: WB-STRAIN:VC1356, CGC_VC1356
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T07C5.3. Superficially wild type. External left primer: TTCGCATAGGATTGTTGCAG. External right primer: GGTTGGCTTCTGCAGTTTTC. Internal left primer: GTTTGTTCTCACTGGACGCA. Internal right primer: ATCACAACGACCGGCTATTC. Internal WT amplicon: 1847 bp. Deletion size: 337 bp. Deletion left flank: CGATTGAAACGAGACGTTGGAAAATTAGTA. Deletion right flank: TGCTCCTTTGAAAAAGTATTTCAAATCTTT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036540 Copy   


  • RRID:WB-STRAIN:WBStrain00036543

http://www.wormbase.org/db/get?name=WBStrain00036543

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)
Genomic Alteration: WBGene00000254(bli-4)
Availability: available
Source References: EMPTY
Synonyms: Y48G1C.7(ok1850) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1360, CGC_VC1360
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48G1C.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1850 homozygotes (sterile with no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGGGTCGACTATCACATCA. External right primer: CTCGCAGAGCTCACAAAGTG. Internal left primer: CACAACCACTTGTTCGAGGA. Internal right primer: CGCGTGTAGGATCCATTTTT. Internal WT amplicon: 3378 bp. Deletion size: 985 bp. Deletion left flank: AATTAGATAAAAATTGGATTTTCAGCACAT. Deletion right flank: TTTTTTACTTTCGGAACGTCCCACTTTTGC."

Proper citation: RRID:WB-STRAIN:WBStrain00036543 Copy   


  • RRID:WB-STRAIN:WBStrain00036545

http://www.wormbase.org/db/get?name=WBStrain00036545

Source Database: WormBase (WB)
Affected Genes: WBGene00006393(taf-11.1)
Genomic Alteration: WBGene00006393(taf-11.1)
Availability: available
Source References: EMPTY
Synonyms: taf-11.1(gk648) X.
Alternate IDs: WB-STRAIN:VC1362, CGC_VC1362
Notes: F48D6.1. External left primer: AACCCAGTTTGGCTTTTGTG. External right primer: ACTAAACTGCGCCGACATCT. Internal left primer: TAATGCAAATGGGAATGCAA. Internal right primer: CGGCAAATTGTTGATCACTG. Internal WT amplicon: 2477 bp. Deletion size: 794 bp. Deletion left flank: TACCAAGCATTGATTCAACAACATCAGCCG. Deletion right flank: ATATAATCAGATTCTAATGAAAAAAAGTAA.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00036545 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X