Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
twk-16(syb2541[wrmScarlet::degron::twk-16]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051801 | Caenorhabditis elegans | twk-16(syb2541[wrmScarlet::degron::twk-16]) X. | Made_by: Ravi Das|"wrmScarlet::degron tag inserted into the N-terminus of the endogenous twk-16 locus using CRISPR. wScarlet::TWK-16 expression in DVA and some neurons around the nerve ring. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987" | WBGene00006670(twk-16) | WBGene00006670(twk-16) | WB-STRAIN:WBStrain00051801 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051767 | Caenorhabditis elegans | vha-14(luc138) vha-1(luc132) III; vha-11(luc130) vha-8(luc135) IV; vha-13(luc133) V; vha-12(luc139) X. | Made_by: Paula Gutirrez-Prez|"vha gain-of-function alleles created by replacing the miR-1 binding sites (ACATTCCA) in the 3' UTRs of the endogenous loci with a NotI (GCGGCCGC) restriction site. (vha-12 gain-of-function allele was created by replacing three miR-1 binding sites (ACATTCCA) with NotI (GCGGCCGC), BamHI (GGATCC), and EcoRI (GAATTC) restriction sites.) Referred as 6x-vhaNotI. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644." | WBGene00006910(vha-1)|WBGene00006917(vha-8)|WBGene00006920(vha-11)|WBGene00006921(vha-12)|WBGene00010130(vha-14)|WBGene00013025(vha-13) | WBGene00006910(vha-1), WBGene00006917(vha-8), WBGene00006920(vha-11), WBGene00006921(vha-12), WBGene00010130(vha-14), WBGene00013025(vha-13) | WB-STRAIN:WBStrain00051767 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
vha-8(luc135) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051766 | Caenorhabditis elegans | vha-8(luc135) IV. | Made_by: Paula Gutirrez-Prez|"vha-8 gain-of-function allele created by replacing the miR-1 binding site (ACATTCCA) in the 3' UTR of the endogenous locus with a NotI (GCGGCCGC) restriction site. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644." | WBGene00006917(vha-8) | WBGene00006917(vha-8) | WB-STRAIN:WBStrain00051766 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
nIs686 III; lin-15B&lin-15A(n765) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051805 | Caenorhabditis elegans | nIs686 III; lin-15B&lin-15A(n765) X. | nIs686 [gpa-16p::GCaMP3::unc-54 3' UTR + lin-15(+)] III. Expression of GCaMP in RIP, pharyngeal muscle (pm2, pm3, and dimly/occasionally in pm1), mc1 marginal cells, and other unidentified cells. Derived by gamma-irradiation of nEx2309 in parental strain MT23222 and out-crossed five times to MT8189 lin-15B&lin-15A(n765). Reference: Sando SR, et al. eLife 2021;10:e59341 doi: 10.7554/eLife.59341 | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00051805 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
nIs348 IV; lin-15AB(n765) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051804 | Caenorhabditis elegans | nIs348 IV; lin-15AB(n765) X. | nIs348 [ceh-28p::4XNLS::mCherry + lin-15(+)] IV. Reporter construct contains 2.4 kb of ceh-28 promoter. Reference: Hirose T, et al. Proc Natl Acad Sci. 2010 Aug 31;107(35):15479-84. PMID: 20713707 | WBGene00003004(lin-15) | WBGene00003004(lin-15) | WB-STRAIN:WBStrain00051804 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051769 | Caenorhabditis elegans | vha-1(luc161) III/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested hT2 aneuploids, and non-GFP luc161 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. vha-1(luc161) is a 454 bp deletion removing most of the coding sequence. Reference: Gutierrez-Prez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.|"Made_by: Paula Gutirrez-Prez" | WBGene00000254(bli-4)|WBGene00006910(vha-1) | WBGene00000254(bli-4), WBGene00006910(vha-1) | WB-STRAIN:WBStrain00051769 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
trp-4(mir35mir36[trp-4::gfp]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051802 | Caenorhabditis elegans | trp-4(mir35mir36[trp-4::gfp]) I. | GFP tag inserted into the N-terminus of the endogenous trp-4 locus using a two-step nested CRISPR method. The GFP signal is more prominent on the tip of the nose of the animals. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987|"Made_by: Ravi Das" | WBGene00006616(trp-4) | WBGene00006616(trp-4) | WB-STRAIN:WBStrain00051802 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00051808 | Caenorhabditis elegans | mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. | Made_by: Carlos Mora-Martnez|"mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334" | WBGene00003387(mod-5) | WBGene00003387(mod-5) | WB-STRAIN:WBStrain00051808 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 2 | ||||
|
rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051807 | Caenorhabditis elegans | rrf-3(pk1426) II; lite-1(ce314) X; vlcEx1292. | Made_by: ngela Jimeno|"vlcEx1292 [srh-142p::mCherry::SL2::GCaMP3 + unc-122p::RFP]. Maintain at or below 20C; sterile at 25C. Pick animals with RFP+ coelomocytes to maintain. ADF-specific expression of GCaMP3. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334" | WBGene00001803(lite-1)|WBGene00004510(rrf-3) | WBGene00001803(lite-1), WBGene00004510(rrf-3) | WB-STRAIN:WBStrain00051807 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
egl-1(cdb97) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051756 | Caenorhabditis elegans | egl-1(cdb97) V. | Brood size slightly reduced at 25 degrees. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039 | WBGene00001170(egl-1) | WBGene00001170(egl-1) | WB-STRAIN:WBStrain00051756 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
mir-35(cdb2 cdb4) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051755 | Caenorhabditis elegans | mir-35(cdb2 cdb4) II. | Made_by: Bridget Donnelly|"Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039" | WBGene00003263(mir-35) | WBGene00003263(mir-35) | WB-STRAIN:WBStrain00051755 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
wIs51 V; icbSi2. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051754 | Caenorhabditis elegans | wIs51 V; icbSi2. | Made_by: Mark Hintze|"wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193." | WB-STRAIN:WBStrain00051754 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||||
|
kasIs7. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051742 | Caenorhabditis elegans | kasIs7. | kasIs7 [snb-1p::C9 ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: https:|"Made_by: Yoshifumi Sonobe" | WB-STRAIN:WBStrain00051742 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||||
|
kasEx161. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051746 | Caenorhabditis elegans | kasEx161. | kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821"|"Made_by: Yoshifumi Sonobe" | WB-STRAIN:WBStrain00051746 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||||
|
kasEx159. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051745 | Caenorhabditis elegans | kasEx159. | kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"kasEx159 [unc-11p::(delta)C9 neuro + myo-2::GFP]. The transgene has the unc-11 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821"|"Made_by: Yoshifumi Sonobe" | WB-STRAIN:WBStrain00051745 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||||
|
kasIs9. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051743 | Caenorhabditis elegans | kasIs9. | kasIs9 [snb-1p::(delta)C9 ubi + myo-2::GFP]. The transgene has the snb-1 promoter followed by nanoluciferase sequence and unc-54 3'UTR. Reference: https:|"Made_by: Yoshifumi Sonobe" | WB-STRAIN:WBStrain00051743 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||||
|
lea-1(cp423[myo-2p::GFP::myo-2 3'UTR]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051748 | Caenorhabditis elegans | lea-1(cp423[myo-2p::GFP::myo-2 3'UTR]) V. | Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234 | WBGene00002263(lea-1)|WBGene00003514(myo-2) | WBGene00002263(lea-1), WBGene00003514(myo-2) | WB-STRAIN:WBStrain00051748 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 | ||||
|
kasIs10. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051747 | Caenorhabditis elegans | kasIs10. | kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821|"Made_by: Yoshifumi Sonobe" | WB-STRAIN:WBStrain00051747 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||||
|
peIs422. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051739 | Caenorhabditis elegans | peIs422. | peIs422 [gcy-5p::Downward DAG2(worm) + gcy-5p::mCherry + unc-122p::mCherry]. Transgene allows imaging of changes in the amount of diacylglycerol (DAG) in ASER neuron. Reference: Ohno H, et al. Cell Rep. 2017 Sep 5;20(10):2294-2303. PMID: 28877465 | WB-STRAIN:WBStrain00051739 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:47 | 0 | ||||||
|
daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) unc-119(ed3) III; ieSi38 IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051793 | Caenorhabditis elegans | daf-16(hq389[daf-16::gfp::degron]) I; daf-2(e1370) unc-119(ed3) III; ieSi38 IV. | ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering.This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the germ line. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https:|"Made_by: Yan-Ping Zhang, Wen-Hong Zhang" | WBGene00000898(daf-2)|WBGene00000912(daf-16)|WBGene00006843(unc-119) | WBGene00000898(daf-2), WBGene00000912(daf-16), WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051793 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:48 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
