Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
tomm-22(gk5793[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051393 | Caenorhabditis elegans | tomm-22(gk5793[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2114 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAAAACAGGGGAAAATCTAGGAAAAGATC. Right flanking sequence: TGGAAATTGGCGTTTTACAATGCAAAAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021133(tomm-22) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021133(tomm-22) | WB-STRAIN:WBStrain00051393 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:35 | 0 | ||||
|
R07E5.7(gk5791[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051391 | Caenorhabditis elegans | R07E5.7(gk5791[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 849 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAGTGATCACAAATAAGTAAACGAGGTCCA. Right flanking sequence: GTTTAACACAAACACAACACTGAAAATAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051391 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:44 | 0 | ||||
|
gex-4(gk5795[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051395 | Caenorhabditis elegans | gex-4(gk5795[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | Made_by: Vancouver KO Group|"Y75B8A.14. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1856 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTTCCAAATTTCCGACCACTACTCCTGC. Right flanking sequence: TGGAGCAGGTTTGCATTGCACAGAGTCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013550(gex-4) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013550(gex-4) | WB-STRAIN:WBStrain00051395 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:35 | 0 | ||||
|
M03F8.3(gk5794[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051394 | Caenorhabditis elegans | M03F8.3(gk5794[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3547 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTCTAAAACAACGACACTCCGAAATCCCCT. Right flanking sequence: TCTCAATTCTGTGTTTTTTTTTGTTTGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051394 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:44 | 0 | ||||
|
ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051434 | Caenorhabditis elegans | ZC434.4(gk5836[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Made_by: Vancouver KO Group|"[NOTE: Please see RG5028 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1235 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTCCATTCTTGATATGCAATGTTTTTTAAA. Right flanking sequence: TGGGCTAAGAGTTCCGATGCACCCTCGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051434 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
best-26(gk5835[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051433 | Caenorhabditis elegans | best-26(gk5835[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 4496 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTGTCAACTTTAAAGGCGCATACCTTAGAA. Right flanking sequence: CGGAGATTCAATAGCAGTGCAAAAAAGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00014103(best-26) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00014103(best-26) | WB-STRAIN:WBStrain00051433 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:45 | 0 | ||||
|
C07H6.4(gk5800[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051399 | Caenorhabditis elegans | C07H6.4(gk5800[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 3604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAATCTAACATTTTAAATTATTTCCCGGGA. Right flanking sequence: GTTGGCGGTAGTGATGACATTCATTTTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051399 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:35 | 0 | ||||
|
vps-4(gk5783[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051385 | Caenorhabditis elegans | vps-4(gk5783[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 6128 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCGCCAGCTTATCCCCTGGAACATCCAACC. Right flanking sequence: AACGGCTCACACAACAACTCACACACACAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021334(vps-4) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021334(vps-4) | WB-STRAIN:WBStrain00051385 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:44 | 0 | ||||
|
best-22(gk5782[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051384 | Caenorhabditis elegans | best-22(gk5782[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 5460 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTTGCAAAGCTTTTTCAGCTTATTGTTAC. Right flanking sequence: ATTATATAATTCCGCAAGCTCTGTGATATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013921(best-22) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013921(best-22) | WB-STRAIN:WBStrain00051384 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:35 | 0 | ||||
|
mlt-8(gk5788[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051389 | Caenorhabditis elegans | mlt-8(gk5788[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3372 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTACAGTAAAGCTTGAGTTTTGCATAGT. Right flanking sequence: CGGGGAGAACAATTGGAGAAGAAGAAAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021095(mlt-8) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021095(mlt-8) | WB-STRAIN:WBStrain00051389 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:35 | 0 | ||||
|
ZK1236.5(gk5829[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051427 | Caenorhabditis elegans | ZK1236.5(gk5829[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 668 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GATTCGCTCAGTCCCATCGTTTTCTTGCCG. Right flanking sequence: CGGAGCGTCGTTGGAAATATTTTGGAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051427 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:45 | 0 | ||||
|
vars-1(gk5828[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051426 | Caenorhabditis elegans | vars-1(gk5828[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Made_by: Vancouver KO Group|"[NOTE: Please see RG5047 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGTTTGACAAAAAAATATTTTTTAATCTTC. Right flanking sequence: AGGAACAGTTTCAAGCAAGAATTGCATCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00006935(vars-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00006935(vars-1) | WB-STRAIN:WBStrain00051426 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
copb-1(gk5826[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051424 | Caenorhabditis elegans | copb-1(gk5826[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 10997 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTCTGTCAAAAAATCAATAAAAACCAGGC. Right flanking sequence: GGAAGCCAGAAATCCGTGGGGAAAAGTTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021292(copb-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021292(copb-1) | WB-STRAIN:WBStrain00051424 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:45 | 0 | ||||
|
ltd-1(gk5831[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051429 | Caenorhabditis elegans | ltd-1(gk5831[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 4104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGATAACTAAGGACAATTGGAATACCCT. Right flanking sequence: GTCATAAACATGGCGAGAATAGATGTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003089(ltd-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003089(ltd-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051429 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:36 | 0 | ||||
|
txt-1(gk5905[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051496 | Caenorhabditis elegans | txt-1(gk5905[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 1431 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: CCACGTCCAGTTTTTTAATAGATCACGCCA. Right flanking sequence: TGGCTTTTCTTTTTCTGTTTCCGTTTCTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016807(txt-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016807(txt-1) | WB-STRAIN:WBStrain00051496 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:45 | 0 | ||||
|
taco-1(gk5904[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051495 | Caenorhabditis elegans | taco-1(gk5904[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2838 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: GAATTTTCGATTAAAAACCATGAATATCCA. Right flanking sequence: GGGTGAAAAATAACGAGAAACACGATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021757(taco-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021757(taco-1) | WB-STRAIN:WBStrain00051495 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:37 | 0 | ||||
|
frpr-11(sy1278) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051533 | Caenorhabditis elegans | frpr-11(sy1278) V. | Batch Strain object requested via get_NS_ids.pl|"Made_by: Heenam Park & Mandy Tan"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-11. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAACTGCTTCCTCATCTTTAAACTCACACAGTTATG right flanking sequence: ATATGGTTGAAGTGTTTGCTATGATTATGTTGCC Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACTCACACAGTTATGATA Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00019444(frpr-11) | WBGene00019444(frpr-11) | WB-STRAIN:WBStrain00051533 | WormBase (WB) | WB | unknown | PMID:34741504 | 2026-08-01 10:23:38 | 0 | |||
|
frpr-5(sy1274) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051532 | Caenorhabditis elegans | frpr-5(sy1274) V. | Batch Strain object requested via get_NS_ids.pl|"Made_by: Heenam Park & Mandy Tan"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of frpr-5. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. left flanking sequence: gATGAAAATGCAGATCTCCTCGCGTACACCAAAA right flanking sequence: CGTTGGCTTGCCGAGGTGAACATTGTAGATGTTG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGGCAAGCCAACGTTT Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00008342(frpr-5) | WBGene00008342(frpr-5) | WB-STRAIN:WBStrain00051532 | WormBase (WB) | WB | unknown | PMID:34741504 | 2026-08-01 10:23:46 | 0 | |||
|
hlh-30(syb1452 [hlh-30::3xFLAG::eGFP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051498 | Caenorhabditis elegans | hlh-30(syb1452 [hlh-30::3xFLAG::eGFP]) IV. | 3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793|"Made_by: SunyBiotech & VZ Lab" | WBGene00020930(hlh-30) | WBGene00020930(hlh-30) | WB-STRAIN:WBStrain00051498 | WormBase (WB) | WB | unknown | PMID:37749091 | 2026-08-01 10:23:37 | 0 | |||
|
npr-33(sy1272) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051531 | Caenorhabditis elegans | npr-33(sy1272) X. | Batch Strain object requested via get_NS_ids.pl|"Made_by: Heenam Park & Mandy Tan"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-33. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAAACGAGCACATTGATAAGTGTACTGGCCACCC right flanking sequence: AATCAGCTCCGCTTCAATGCTTTTCCTGTCATCCG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGAAGCGGAGCTGATTGGG Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616" | WBGene00009278(npr-33) | WBGene00009278(npr-33) | WB-STRAIN:WBStrain00051531 | WormBase (WB) | WB | unknown | PMID:34741504 PMID:38446031 |
2026-08-01 10:23:37 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
