Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Database:WB (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Species

Sort Ascending

Sort Descending

 Synonyms

Sort Ascending

Sort Descending

 Notes
Phenotype

Sort Ascending

Sort Descending

 Affected Gene

Sort Ascending

Sort Descending

 Genomic Alteration

Sort Ascending

Sort Descending

 Catalog Number
Background

Sort Ascending

Sort Descending

 Database

Sort Ascending

Sort Descending

 Database Abbreviation

Sort Ascending

Sort Descending

 Availability

Sort Ascending

Sort Descending

 Source References

Sort Ascending

Sort Descending

 Alternate IDs
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
NF199
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028702 Caenorhabditis elegans sqv-5(k175) I. DTC migration defect. WBGene00005023(sqv-5) WBGene00005023(sqv-5) WB-STRAIN:WBStrain00028702 WormBase (WB) WB available PMID:26944260 WB-STRAIN:NF199, CGC_NF199 2026-07-25 10:22:26 0
NF317
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028704 Caenorhabditis elegans mig-23(k180) X. Distal tip cell migration defective. Tc1 insertion mutant. Spontaneous mutant with ventral white patch phenotype. WBGene00003254(mig-23) WBGene00003254(mig-23) WB-STRAIN:WBStrain00028704 WormBase (WB) WB available WB-STRAIN:NF317, CGC_NF317 2026-07-25 10:22:25 0
NIC200
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028787 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Isotype: NIC199|"Reference_strain: False"|"Sequenced: True" WB-STRAIN:WBStrain00028787 WormBase (WB) WB unknown PMID:33820969 WB-STRAIN:NIC200 2026-07-25 10:22:27 0
NIC166
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028781 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Isotype: NIC166|"Reference_strain: True"|"Sequenced: True" WB-STRAIN:WBStrain00028781 WormBase (WB) WB unknown PMID:33820969
PMID:38564369		 WB-STRAIN:NIC166 2026-07-25 10:22:27 0
NIC195
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028782 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Isotype: NIC195|"Reference_strain: True"|"Sequenced: True" WB-STRAIN:WBStrain00028782 WormBase (WB) WB unknown PMID:33820969
PMID:38564369		 WB-STRAIN:NIC195 2026-07-25 10:22:27 0
NIC4
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028780 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Isotype: NIC3|"Reference_strain: False"|"Sequenced: True" WB-STRAIN:WBStrain00028780 WormBase (WB) WB unknown PMID:33820969 WB-STRAIN:NIC4 2026-07-25 10:22:27 0
NH2693
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028774 Caenorhabditis elegans +/szT1 [lon-2(e678)] I; egl-15(n1456)/szT1 X. Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).|"Made_by: R. Burdine" WBGene00001184(egl-15)|WBGene00003056(lon-2) WBGene00001184(egl-15), WBGene00003056(lon-2) WB-STRAIN:WBStrain00028774 WormBase (WB) WB available PMID:7585964 WB-STRAIN:NH2693, CGC_NH2693 2026-07-25 10:22:27 0
NH3027
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028775 Caenorhabditis elegans ncl-1(e1865) III; egl-15(n1456) X; ayEx86. ayEx86 [col-19::GFP + egl-15(+) (NH#112) + ncl-1(+)(c33c3)]. Maintain by picking non-Egl. Referene: Lo TW, et al. Dev Biol. 2008 Jun 15;318(2):268-75.|"Made_by: Catherine Branda" WBGene00001184(egl-15)|WBGene00003559(ncl-1) WBGene00001184(egl-15), WBGene00003559(ncl-1) WB-STRAIN:WBStrain00028775 WormBase (WB) WB available WB-STRAIN:NH3027, CGC_NH3027 2026-07-25 10:22:27 0
NH3119
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028776 Caenorhabditis elegans F54A5.3a(ok198) I. Mutagen:UV/TMP|"No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3." WBGene00018788(shc-1) WBGene00018788(shc-1) WB-STRAIN:WBStrain00028776 WormBase (WB) WB available WB-STRAIN:NH3119, CGC_NH3119 2026-07-25 10:22:27 0
NFB1352
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028723 Caenorhabditis elegans vlcEx800. Made_by: Carla Lloret & Carlos Mora|"vlcEx800 [pan-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pan-1 enhancer sequence (-1050, -148) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WB-STRAIN:WBStrain00028723 WormBase (WB) WB available WB-STRAIN:NFB1352, CGC_NFB1352 2026-07-25 10:22:26 0
NFB1369
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028724 Caenorhabditis elegans ast-1(vlc19[ast-1::GFP]) II. Made_by: Carla Lloret & Carlos Mora|"vlc19[ast-1::GFP] II. Superficially wild-type. Endogenous ast-1 locus tagged with GFP using Cas9-triggered homologous recombination. GFP was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WBGene00020368(ast-1) WBGene00020368(ast-1) WB-STRAIN:WBStrain00028724 WormBase (WB) WB available WB-STRAIN:NFB1369, CGC_NFB1369 2026-07-25 10:22:26 0
NFB1692
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028725 Caenorhabditis elegans hlh-3(vlc28[hlh-3::mNeonGreen]) II. Made_by: Carla Lloret & Carlos Mora|"vlc28[hlh-3::mNeonGreen] II. Superficially wild-type. Endogenous hlh-3 locus tagged with mNeonGreen using Cas9-triggered homologous recombination. mNeonGreen was inserted at the C-terminus using a 9 amino acid flexible linker present in the plasmids (Dickinson et al., 2015). Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WBGene00001950(hlh-3) WBGene00001950(hlh-3) WB-STRAIN:WBStrain00028725 WormBase (WB) WB available WB-STRAIN:NFB1692, CGC_NFB1692 2026-07-25 10:22:26 0
NFB1895
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028726 Caenorhabditis elegans vlcEx1091. Made_by: Carla Lloret & Carlos Mora|"vlcEx1091 [snt-1p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains snt-1 enhancer sequence (+993, +2170) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WB-STRAIN:WBStrain00028726 WormBase (WB) WB available WB-STRAIN:NFB1895, CGC_NFB1895 2026-07-25 10:22:26 0
NFB1181
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028720 Caenorhabditis elegans vlcEx683. Made_by: Carla Lloret & Carlos Mora|"vlcEx683 [mgl-2p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains mgl-2 enhancer sequence (-4183, -3367) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WB-STRAIN:WBStrain00028720 WormBase (WB) WB available WB-STRAIN:NFB1181, CGC_NFB1181 2026-07-25 10:22:26 0
NFB1151
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028717 Caenorhabditis elegans vlcEx653. Made_by: Carla Lloret & Carlos Mora|"vlcEx653 [pde-3p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains pde-3 enhancer sequence (-2539, -1599) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WB-STRAIN:WBStrain00028717 WormBase (WB) WB available WB-STRAIN:NFB1151, CGC_NFB1151 2026-07-25 10:22:26 0
NFB1164
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028718 Caenorhabditis elegans vlcEx666. Made_by: Carla Lloret & Carlos Mora|"vlcEx666 [klp-7p::GFP::unc-54 3'UTR + rol-6(su1006)]. Not all transgenic animals roll well; pick GFP+ or Rollers to maintain. Reporter contains klp-7 enhancer sequence (+1434, +2287) inserted into pDD95.75. Reference: Lloret-Fernndez et al. eLife 2018;7:e32785 DOI: 10.7554/eLife.32785." WB-STRAIN:WBStrain00028718 WormBase (WB) WB available WB-STRAIN:NFB1164, CGC_NFB1164 2026-07-25 10:22:26 0
NF1684
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028710 Caenorhabditis elegans cogc-3(k181) I. Distal tip cell migration defective. Growth delay. Protruding vulva. WBGene00022121(cogc-3) WBGene00022121(cogc-3) WB-STRAIN:WBStrain00028710 WormBase (WB) WB available WB-STRAIN:NF1684, CGC_NF1684 2026-07-25 10:22:26 0
NK773
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028870 Caenorhabditis elegans unc-119(ed4) III; qyEx114. qyEx114 [C28C12.10::GFP + unc-119(+)]. Maintain by picking non-Unc. WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00028870 WormBase (WB) WB available WB-STRAIN:NK773, CGC_NK773 2026-07-25 10:22:28 0
NK774
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028871 Caenorhabditis elegans unc-119(ed4) III; qyEx116. qyEx116 [C14A11.3b::GFP + unc-119(+)]. Maintain by picking non-Unc.|"Supplementary_genotype qyEx116 [pcgef-1b::GFP + unc-119(+)]" WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00028871 WormBase (WB) WB available PMID:37756590 WB-STRAIN:NK774, CGC_NK774 2026-07-25 10:22:28 0
NK775
 
Resource Report
Resource Website 		RRID:WB-STRAIN:WBStrain00028872 Caenorhabditis elegans unc-119(ed4) III; qyEx117. qyEx117 [C14A11.3a,c::GFP + unc-119(+)]. Maintain by picking non-Unc.|"Supplementary_genotype qyEx117 [pcgef-1a,c::GFP + unc-119(+)]" WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00028872 WormBase (WB) WB available PMID:37756590 WB-STRAIN:NK775, CGC_NK775 2026-07-25 10:22:28 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X

  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the ASWG Community.

Recent News Entries

Is the future of peer review automated?

Automated screening of COVID-19 preprints: can we help authors to improve transparency and reproducibility?

rTransparent

Contact Us

Our Information

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch