Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 103 showing 2041 ~ 2060 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00051062

http://www.wormbase.org/db/get?name=WBStrain00051062

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: mikSi1 II; ltIs38.
Notes: Made_by: Anna Christina Erpf|"mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256."

Proper citation: RRID:WB-STRAIN:WBStrain00051062 Copy   


  • RRID:WB-STRAIN:WBStrain00051061

http://www.wormbase.org/db/get?name=WBStrain00051061

Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: unknown
Source References: EMPTY
Synonyms: smg-1(gk761853) I.
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00051061 Copy   


  • RRID:WB-STRAIN:WBStrain00051067

http://www.wormbase.org/db/get?name=WBStrain00051067

Source Database: WormBase (WB)
Affected Genes: WBGene00001803(lite-1)
Genomic Alteration: WBGene00001803(lite-1)
Availability: unknown
Source References: EMPTY
Synonyms: lite-1(xu492) X.
Notes: Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5 CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5 GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5 GAAGCAACAAGACGATCTCC; Forward (internal): 5 ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Proper citation: RRID:WB-STRAIN:WBStrain00051067 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051100

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C34D4.2(gk3801[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTAGTCAGTATTTTTACTTGCCAGACG. Right flanking sequence: CGGACAAAGTTTTCTTGCTCCGAGGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051100 Copy   


  • RRID:WB-STRAIN:WBStrain00051066

http://www.wormbase.org/db/get?name=WBStrain00051066

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Y74C10AL.2(ogr3) I.
Notes: Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa

Proper citation: RRID:WB-STRAIN:WBStrain00051066 Copy   


  • RRID:WB-STRAIN:WBStrain00051065

http://www.wormbase.org/db/get?name=WBStrain00051065

Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: T09F3.2(ogr2) II.
Notes: Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt

Proper citation: RRID:WB-STRAIN:WBStrain00051065 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051102

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019077(zipt-11)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019077(zipt-11)
Availability: unknown
Source References: EMPTY
Synonyms: zipt-11(gk3833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTTATCAGGCGCTTCTTGCGGCCACATT. Right flanking sequence: GGGTTAAACTCGGAAACTTGTTCACAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051102 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051101

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II.
Notes: Made_by: Vancouver KO Group|"[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00051101 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051107

Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Notes: Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051107 Copy   


  • RRID:WB-STRAIN:WBStrain00051050

http://www.wormbase.org/db/get?name=WBStrain00051050

Source Database: WormBase (WB)
Affected Genes: WBGene00022296(xpc-1)
Genomic Alteration: WBGene00022296(xpc-1)
Availability: unknown
Source References: EMPTY
Synonyms: xpc-1(tm3886) IV.
Notes: Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.

Proper citation: RRID:WB-STRAIN:WBStrain00051050 Copy   


  • RRID:WB-STRAIN:WBStrain00051058

http://www.wormbase.org/db/get?name=WBStrain00051058

Source Database: WormBase (WB)
Affected Genes: WBGene00018908(fncm-1)
Genomic Alteration: WBGene00018908(fncm-1)
Availability: unknown
Source References: EMPTY
Synonyms: fncm-1(tm3148) I.
Notes: Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Proper citation: RRID:WB-STRAIN:WBStrain00051058 Copy   


  • RRID:WB-STRAIN:WBStrain00051057

http://www.wormbase.org/db/get?name=WBStrain00051057

Source Database: WormBase (WB)
Affected Genes: WBGene00020935(fnci-1)
Genomic Alteration: WBGene00020935(fnci-1)
Availability: unknown
Source References: EMPTY
Synonyms: fnci-1(tm3081) I.
Notes: Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Proper citation: RRID:WB-STRAIN:WBStrain00051057 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051041

Source Database: WormBase (WB)
Affected Genes: WBGene00017546(rpa-1)|WBGene00019079(rpa-4)|WBGene00019767(rpa-2)
Genomic Alteration: WBGene00017546(rpa-1), WBGene00019079(rpa-4), WBGene00019767(rpa-2)
Availability: unknown
Source References: EMPTY
Synonyms: rpa-4(iow128[Myc::rpa-4]) rpa-2(iow49[3xFLAG::rpa-2]) I; rpa-1(iow92[OLLAS::rpa-1]) II.
Notes: CRISPR/Cas9 engineering used to insert N-terminal Myc tag into the endogenous rpa-4 locus, N-terminal 3xFLAG tag into the endogenous rpa-2 locus, and N-terminal OLLAS tag into the endogenous rpa-1 locus. SSM559 was generated by crossing rpa-2(iow49) with rpa-1(iow92), followed by CRISPR insertion of the Myc tag into rpa-4. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.|"Made_by: Adam Hefel"

Proper citation: RRID:WB-STRAIN:WBStrain00051041 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051040

Source Database: WormBase (WB)
Affected Genes: WBGene00017546(rpa-1)
Genomic Alteration: WBGene00017546(rpa-1)
Availability: unknown
Source References: EMPTY
Synonyms: rpa-1(iow92[OLLAS::rpa-1]) II.
Notes: Made_by: Adam Hefel|"N-terminal OLLAS tag inserted into the endogenous rpa-1 locus using Crispr/Cas9. Generated in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293."

Proper citation: RRID:WB-STRAIN:WBStrain00051040 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051045

Source Database: WormBase (WB)
Affected Genes: WBGene00004393(rnt-1)
Genomic Alteration: WBGene00004393(rnt-1)
Availability: unknown
Source References: EMPTY
Synonyms: rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I.
Notes: eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.|"Made_by: Van den Heuvel lab"

Proper citation: RRID:WB-STRAIN:WBStrain00051045 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051044

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hrtSi57 II; unc-119(ed3) III.
Notes: hrtSi57 [gcy-36p::gcy-35::mKate2 + unc-119(+)] II. hrtSi57 inserted into ttTi5605. mKate2 inserted into gcy-35 after S671 to generate a functional expression construct (Gross et al., 2014). Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

Proper citation: RRID:WB-STRAIN:WBStrain00051044 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051043

Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: unknown
Source References: EMPTY
Synonyms: hrtSi27 II; unc-119(ed3) III.
Notes: hrtSi27 [des-2p::CRE + unc-119(+)] II. hrtSi27 inserted into ttTi5605. CRE expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025.

Proper citation: RRID:WB-STRAIN:WBStrain00051043 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051042

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00017546(rpa-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00017546(rpa-1)
Availability: unknown
Source References: EMPTY
Synonyms: rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II.
Notes: Crispr/Cas9-engineered indel in the 5 region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.|"Made_by: Adam Hefel"

Proper citation: RRID:WB-STRAIN:WBStrain00051042 Copy   


  • RRID:WB-STRAIN:WBStrain00051048

http://www.wormbase.org/db/get?name=WBStrain00051048

Source Database: WormBase (WB)
Affected Genes: WBGene00013241(ung-1)
Genomic Alteration: WBGene00013241(ung-1)
Availability: unknown
Source References: EMPTY
Synonyms: ung-1(tm2862) III.
Notes: Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36.

Proper citation: RRID:WB-STRAIN:WBStrain00051048 Copy   


http://www.wormbase.org/db/get?name=WBStrain00051139

Source Database: WormBase (WB)
Affected Genes: WBGene00003062(lpd-6)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003062(lpd-6), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
Source References: EMPTY
Synonyms: lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I.
Notes: Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3234 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAATCCTCCATCACGATCTCCCGATCTTC. Right flanking sequence: CTGACGACAAGTTTTTTACCGCGATTTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00051139 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X