Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
mikSi1 II; ltIs38.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051062 Caenorhabditis elegans mikSi1 II; ltIs38. Made_by: Anna Christina Erpf|"mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256." WB-STRAIN:WBStrain00051062 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
smg-1(gk761853) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051061 Caenorhabditis elegans smg-1(gk761853) I. EMPTY WBGene00004879(smg-1) WBGene00004879(smg-1) WB-STRAIN:WBStrain00051061 WormBase (WB) WB unknown 2026-08-01 10:23:41 0
lite-1(xu492) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051067 Caenorhabditis elegans lite-1(xu492) X. Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5 CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5 GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5 GAAGCAACAAGACGATCTCC; Forward (internal): 5 ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec. WBGene00001803(lite-1) WBGene00001803(lite-1) WB-STRAIN:WBStrain00051067 WormBase (WB) WB unknown 2026-08-01 10:23:41 0
C34D4.2(gk3801[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051100 Caenorhabditis elegans C34D4.2(gk3801[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTAGTCAGTATTTTTACTTGCCAGACG. Right flanking sequence: CGGACAAAGTTTTCTTGCTCCGAGGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00051100 WormBase (WB) WB unknown 2026-08-01 10:23:42 0
Y74C10AL.2(ogr3) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051066 Caenorhabditis elegans Y74C10AL.2(ogr3) I. Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa WB-STRAIN:WBStrain00051066 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
T09F3.2(ogr2) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051065 Caenorhabditis elegans T09F3.2(ogr2) II. Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt WB-STRAIN:WBStrain00051065 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
zipt-11(gk3833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051102 Caenorhabditis elegans zipt-11(gk3833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTTATCAGGCGCTTCTTGCGGCCACATT. Right flanking sequence: GGGTTAAACTCGGAAACTTGTTCACAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019077(zipt-11) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019077(zipt-11) WB-STRAIN:WBStrain00051102 WormBase (WB) WB unknown 2026-08-01 10:23:31 0
eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051101 Caenorhabditis elegans eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Made_by: Vancouver KO Group|"[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00051101 WormBase (WB) WB unknown 2026-08-01 10:23:31 0
C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051107 Caenorhabditis elegans C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00051107 WormBase (WB) WB unknown 2026-08-01 10:23:31 0
xpc-1(tm3886) IV.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051050 Caenorhabditis elegans xpc-1(tm3886) IV. Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36. WBGene00022296(xpc-1) WBGene00022296(xpc-1) WB-STRAIN:WBStrain00051050 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
fncm-1(tm3148) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051058 Caenorhabditis elegans fncm-1(tm3148) I. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169. WBGene00018908(fncm-1) WBGene00018908(fncm-1) WB-STRAIN:WBStrain00051058 WormBase (WB) WB unknown 2026-08-01 10:23:41 0
fnci-1(tm3081) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051057 Caenorhabditis elegans fnci-1(tm3081) I. Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169. WBGene00020935(fnci-1) WBGene00020935(fnci-1) WB-STRAIN:WBStrain00051057 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
rpa-4(iow128[Myc::rpa-4]) rpa-2(iow49[3xFLAG::rpa-2]) I; rpa-1(iow92[OLLAS::rpa-1]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051041 Caenorhabditis elegans rpa-4(iow128[Myc::rpa-4]) rpa-2(iow49[3xFLAG::rpa-2]) I; rpa-1(iow92[OLLAS::rpa-1]) II. CRISPR/Cas9 engineering used to insert N-terminal Myc tag into the endogenous rpa-4 locus, N-terminal 3xFLAG tag into the endogenous rpa-2 locus, and N-terminal OLLAS tag into the endogenous rpa-1 locus. SSM559 was generated by crossing rpa-2(iow49) with rpa-1(iow92), followed by CRISPR insertion of the Myc tag into rpa-4. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.|"Made_by: Adam Hefel" WBGene00017546(rpa-1)|WBGene00019079(rpa-4)|WBGene00019767(rpa-2) WBGene00017546(rpa-1), WBGene00019079(rpa-4), WBGene00019767(rpa-2) WB-STRAIN:WBStrain00051041 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
rpa-1(iow92[OLLAS::rpa-1]) II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051040 Caenorhabditis elegans rpa-1(iow92[OLLAS::rpa-1]) II. Made_by: Adam Hefel|"N-terminal OLLAS tag inserted into the endogenous rpa-1 locus using Crispr/Cas9. Generated in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293." WBGene00017546(rpa-1) WBGene00017546(rpa-1) WB-STRAIN:WBStrain00051040 WormBase (WB) WB unknown 2026-08-01 10:23:41 0
rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051045 Caenorhabditis elegans rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.|"Made_by: Van den Heuvel lab" WBGene00004393(rnt-1) WBGene00004393(rnt-1) WB-STRAIN:WBStrain00051045 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
hrtSi57 II; unc-119(ed3) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051044 Caenorhabditis elegans hrtSi57 II; unc-119(ed3) III. hrtSi57 [gcy-36p::gcy-35::mKate2 + unc-119(+)] II. hrtSi57 inserted into ttTi5605. mKate2 inserted into gcy-35 after S671 to generate a functional expression construct (Gross et al., 2014). Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00051044 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
hrtSi27 II; unc-119(ed3) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051043 Caenorhabditis elegans hrtSi27 II; unc-119(ed3) III. hrtSi27 [des-2p::CRE + unc-119(+)] II. hrtSi27 inserted into ttTi5605. CRE expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00051043 WormBase (WB) WB unknown 2026-08-01 10:23:41 0
rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051042 Caenorhabditis elegans rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. Crispr/Cas9-engineered indel in the 5 region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.|"Made_by: Adam Hefel" WBGene00001072(dpy-10)|WBGene00017546(rpa-1) WBGene00001072(dpy-10), WBGene00017546(rpa-1) WB-STRAIN:WBStrain00051042 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
ung-1(tm2862) III.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051048 Caenorhabditis elegans ung-1(tm2862) III. Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36. WBGene00013241(ung-1) WBGene00013241(ung-1) WB-STRAIN:WBStrain00051048 WormBase (WB) WB unknown 2026-08-01 10:23:30 0
lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I.
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00051139 Caenorhabditis elegans lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3234 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAATCCTCCATCACGATCTCCCGATCTTC. Right flanking sequence: CTGACGACAAGTTTTTTACCGCGATTTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" WBGene00003062(lpd-6)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) WBGene00003062(lpd-6), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) WB-STRAIN:WBStrain00051139 WormBase (WB) WB unknown 2026-08-01 10:23:42 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.