Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
mikSi1 II; ltIs38. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051062 | Caenorhabditis elegans | mikSi1 II; ltIs38. | Made_by: Anna Christina Erpf|"mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256." | WB-STRAIN:WBStrain00051062 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||||
|
smg-1(gk761853) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051061 | Caenorhabditis elegans | smg-1(gk761853) I. | EMPTY | WBGene00004879(smg-1) | WBGene00004879(smg-1) | WB-STRAIN:WBStrain00051061 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
lite-1(xu492) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051067 | Caenorhabditis elegans | lite-1(xu492) X. | Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5 CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5 GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5 GAAGCAACAAGACGATCTCC; Forward (internal): 5 ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec. | WBGene00001803(lite-1) | WBGene00001803(lite-1) | WB-STRAIN:WBStrain00051067 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
C34D4.2(gk3801[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051100 | Caenorhabditis elegans | C34D4.2(gk3801[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. | Homozygous viable. Deletion of 800 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATTAGTCAGTATTTTTACTTGCCAGACG. Right flanking sequence: CGGACAAAGTTTTCTTGCTCCGAGGAAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051100 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 | ||||
|
Y74C10AL.2(ogr3) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051066 | Caenorhabditis elegans | Y74C10AL.2(ogr3) I. | Short-lived at 25C. Sensitive to paraquat. ogr3 is a 1238 bp deletion; flanking sequences: aaaattttttaaaaaaatat - taaaatcttccaacaaaaaaa | WB-STRAIN:WBStrain00051066 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||||
|
T09F3.2(ogr2) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051065 | Caenorhabditis elegans | T09F3.2(ogr2) II. | Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt | WB-STRAIN:WBStrain00051065 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||||
|
zipt-11(gk3833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051102 | Caenorhabditis elegans | zipt-11(gk3833[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. | Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AATTTATCAGGCGCTTCTTGCGGCCACATT. Right flanking sequence: GGGTTAAACTCGGAAACTTGTTCACAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019077(zipt-11) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019077(zipt-11) | WB-STRAIN:WBStrain00051102 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:31 | 0 | ||||
|
eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051101 | Caenorhabditis elegans | eif-3.G(gk3804[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Made_by: Vancouver KO Group|"[NOTE: Please see RG5004 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTGTTATCCGATGGCCAAAAAATTCGCCT. Right flanking sequence: AATGATATCCGAATGTACCATATGGTTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051101 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:31 | 0 | ||||
|
C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051107 | Caenorhabditis elegans | C30E1.9(gk3854[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 11852 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGTTCCCTCACCCTTACTTTCGAATTCCCT. Right flanking sequence: TGGTTGTTTAATATGGTTATTCTTAAGGTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051107 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:31 | 0 | ||||
|
xpc-1(tm3886) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051050 | Caenorhabditis elegans | xpc-1(tm3886) IV. | Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36. | WBGene00022296(xpc-1) | WBGene00022296(xpc-1) | WB-STRAIN:WBStrain00051050 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
fncm-1(tm3148) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051058 | Caenorhabditis elegans | fncm-1(tm3148) I. | Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169. | WBGene00018908(fncm-1) | WBGene00018908(fncm-1) | WB-STRAIN:WBStrain00051058 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
fnci-1(tm3081) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051057 | Caenorhabditis elegans | fnci-1(tm3081) I. | Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169. | WBGene00020935(fnci-1) | WBGene00020935(fnci-1) | WB-STRAIN:WBStrain00051057 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
rpa-4(iow128[Myc::rpa-4]) rpa-2(iow49[3xFLAG::rpa-2]) I; rpa-1(iow92[OLLAS::rpa-1]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051041 | Caenorhabditis elegans | rpa-4(iow128[Myc::rpa-4]) rpa-2(iow49[3xFLAG::rpa-2]) I; rpa-1(iow92[OLLAS::rpa-1]) II. | CRISPR/Cas9 engineering used to insert N-terminal Myc tag into the endogenous rpa-4 locus, N-terminal 3xFLAG tag into the endogenous rpa-2 locus, and N-terminal OLLAS tag into the endogenous rpa-1 locus. SSM559 was generated by crossing rpa-2(iow49) with rpa-1(iow92), followed by CRISPR insertion of the Myc tag into rpa-4. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.|"Made_by: Adam Hefel" | WBGene00017546(rpa-1)|WBGene00019079(rpa-4)|WBGene00019767(rpa-2) | WBGene00017546(rpa-1), WBGene00019079(rpa-4), WBGene00019767(rpa-2) | WB-STRAIN:WBStrain00051041 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
rpa-1(iow92[OLLAS::rpa-1]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051040 | Caenorhabditis elegans | rpa-1(iow92[OLLAS::rpa-1]) II. | Made_by: Adam Hefel|"N-terminal OLLAS tag inserted into the endogenous rpa-1 locus using Crispr/Cas9. Generated in N2 background. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293." | WBGene00017546(rpa-1) | WBGene00017546(rpa-1) | WB-STRAIN:WBStrain00051040 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051045 | Caenorhabditis elegans | rnt-1(he305[rnt-1::eGFP::3xflag::loxP]) I. | eGFP and 3xFlag tags inserted into endogenous rnt-1 locus. Superficially wild-type. Reference: Horst SEM, et al. Development 2019 Nov 18;146(22):dev180034.|"Made_by: Van den Heuvel lab" | WBGene00004393(rnt-1) | WBGene00004393(rnt-1) | WB-STRAIN:WBStrain00051045 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
hrtSi57 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051044 | Caenorhabditis elegans | hrtSi57 II; unc-119(ed3) III. | hrtSi57 [gcy-36p::gcy-35::mKate2 + unc-119(+)] II. hrtSi57 inserted into ttTi5605. mKate2 inserted into gcy-35 after S671 to generate a functional expression construct (Gross et al., 2014). Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051044 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
hrtSi27 II; unc-119(ed3) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051043 | Caenorhabditis elegans | hrtSi27 II; unc-119(ed3) III. | hrtSi27 [des-2p::CRE + unc-119(+)] II. hrtSi27 inserted into ttTi5605. CRE expression in PVD and FLP. Reference: Harterink M, et al. J Cell Sci. 2018 Oct 22;131(20):jcs223107. PMID: 30254025. | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00051043 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:41 | 0 | ||||
|
rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051042 | Caenorhabditis elegans | rpa-1(iow117)/mIn1[mIs14 dpy-10(e128)] II. | Crispr/Cas9-engineered indel in the 5 region of rpa-1. Larval-lethal mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP iow117 homozygotes (larval lethal). Pick wild-type dim GFP and check for correct segregation of progeny to maintain. iow117 was generated in mre-11::GFP background and outcrossed to N2. Reference: Hefel et al., Nucleic Acids Res. 2021 Jan 21;gkaa1293. doi: 10.1093/nar/gkaa1293.|"Made_by: Adam Hefel" | WBGene00001072(dpy-10)|WBGene00017546(rpa-1) | WBGene00001072(dpy-10), WBGene00017546(rpa-1) | WB-STRAIN:WBStrain00051042 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
ung-1(tm2862) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051048 | Caenorhabditis elegans | ung-1(tm2862) III. | Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2014 Oct;24(10):1624-36. | WBGene00013241(ung-1) | WBGene00013241(ung-1) | WB-STRAIN:WBStrain00051048 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:30 | 0 | ||||
|
lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051139 | Caenorhabditis elegans | lpd-6(gk5418[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3234 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAATCCTCCATCACGATCTCCCGATCTTC. Right flanking sequence: CTGACGACAAGTTTTTTACCGCGATTTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003062(lpd-6)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003062(lpd-6), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051139 | WormBase (WB) | WB | unknown | 2026-08-01 10:23:42 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.