Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Strain CSH100 Resource Report Resource Website |
RRID:Addgene_21875 | CSH100 bacterial Strain | None | PMID:19798082 | F’ lac proA+proB+(lacIq lacPL8)/ara- ∆(gpt-lac)5 This strain will be shipped as bacteria in an LB stab. Upon receipt, requesting scientists should restreak the strain on an M9 minimal plate. After restreaking on M9 to confirm the presence of the F', scientists can grow the strain in liquid LB. M9 minimal medium agar plates: To prepare 500 ml, autoclave 439 ml H2O with 7.5 g Bacto-agar and a stir bar. When agar has cooled to approximately 65°C, add 50 ml 10X M9 salts, 1 ml 1 M MgSO4, 10 ml 20% (w/v) glucose and 0.5 ml 100mM CaCl2 and then pour plates. Plates can be stored indefinitely at 4°C in sealed plastic bags. (Alternatively, M9 plates can be purchased from Teknonva: https://www.teknova.com/content/teknova/us/en/products/product-page.html/m1260.html). | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:15:40 | 0 | ||
|
BL21 ΔrecBCD Resource Report Resource Website |
RRID:Addgene_176581 | This is a strain. | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recBCD genomic deletion | 2026-09-19 02:14:27 | 0 | |
|
IF189 Resource Report Resource Website |
RRID:Addgene_134836 | lysogen of a temperature-inducible bacteriophage lambda | None | PMID:28522818 | Genotype is [λ+ Lac- galK2 IN(rrnD-rrnE)1 rph-1], a derivative of strain W3102 Phenotypic assay: Grow at 30°C, but restricted at 42°C due to the induction of phage particles and cell lysis. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:09:22 | 0 | ||
|
LC-E18 Resource Report Resource Website |
RRID:Addgene_115924 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:06:07 | 0 | ||
|
AV04 Resource Report Resource Website |
RRID:Addgene_115926 | none | None | PMID:29765036 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-mCherry Integration at primary 186 attB: pOSIP-KO-RBS2-dCas9 mCherry quantifies dCas9 repression | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:06:07 | 0 | ||
|
39R861+ Resource Report Resource Website |
RRID:Addgene_119737 | None | PMID:30738800 | Strain can be grown on LB without antibiotics. Resistant to: ampicillin, chloramphenicol, florfenicol, gentamicin, kanamycin, nalidixic acid, streptomycin, spectinomycin, sulphonamides, tobramycin, tetracycline, trimethoprim Please note that plasmids are stable in the absence of antibiotic selection. 39R861+ is resistant to nalidixic acid due to a chromosomal mutation. The remaining resistance determinants are plasmid-borne. 39R861+ contains six plasmids, outlined in the supplemental files. | Vector Backbone:See supplemental files for plasmid details; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:06:48 | 0 | |||
|
JS200 strain Resource Report Resource Website |
RRID:Addgene_11794 | JS200 | None | PMID:12909725 | For use with pEP PolI (addgene #11722) and pWT PolI (addgene #11721). This strain contains a temp sens mutation in PolI. | Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:06:30 | 0 | ||
|
FR-E01 Resource Report Resource Website 1+ mentions |
RRID:Addgene_118727 | none | None | PMID:30403660 | E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at HK022 attB: pOSIP-KH-RBS2-dCas9 | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:06:39 | 1 | ||
|
E. coli ER1821ΔlacI Resource Report Resource Website |
RRID:Addgene_141407 | None | PMID:31980824 | λ- F- glnX44 e14- (McrA-) rfbD1 endA1 thi-1 Δ(yjiT-opgB)114::IS10 (EcoKI R- M- McrBC- Mrr-) + rpoS393(am) creC510 lrhA::IS3 ydeN::IS10 ΔlacI Verification of lacI deletion: PCR reaction on genomic DNA using AK362 and AK365 primers produces a 1936 bp fragment AK 362 5’-CAATACCAATCGCACGCGG AK 365 5’-CGAGACGTCACGGAAAATGCC Phenotype: Constitutive β-galactosidase synthesis This strain was derived from the precursor strain, E. coli ER1821, which is described in Jobling et al. (2016) Complete Genome Sequence of Escherichia coli ER1821R, a Laboratory K-12 Derivative Engineered To Be Deficient in All Methylcytosine and Methyladenine Restriction Systems. Genome Announc 4(4):e00763-16. https://www.ncbi.nlm.nih.gov/pubmed/27516504 | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:10:19 | 0 | |||
|
MG1655-OptoCre-bla-P-R Resource Report Resource Website |
RRID:Addgene_188474 | P-R-lox-TT-lox-bla | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:28:54 | 0 | ||
|
MG1655-OptoCre-knt-P-R Resource Report Resource Website |
RRID:Addgene_188475 | P-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:28:54 | 0 | ||
|
MG1655-OptoCre-knt-P*-R Resource Report Resource Website |
RRID:Addgene_188476 | P*-R-lox-TT-lox-knt | None | PMID:36823420 | Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint. | Vector Backbone:E. coli K-12 MG1655; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:28:54 | 0 | ||
|
E. coli MEV15 Resource Report Resource Website |
RRID:Addgene_197112 | None | E. coli MEV15 is engineered to host sesquiterpenoid biosynthetic pathways. Sesquiterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Sesquiterpenoid production can be induced by IPTG, vanillic aci, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and E. coli ispA inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:30:45 | 0 | ||||
|
S4197 Resource Report Resource Website |
RRID:Addgene_200839 | Genotype: MG1655 rph+, ilvG+, ΔlacZ | Escherichia coli str. K-12 substr. MG1655 | None | PMID:20952573 | Corresponding wild-type strain (rapZ+, glmZ+, glmY+) for strain Z956 (Addgene Bacterial strain #200838). | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-09-19 02:31:01 | 0 | |
|
B-95.ΔA Resource Report Resource Website |
RRID:Addgene_197933 | RNA polymerase gene (T7 phage)/chromosome | None | PMID:25982672 | Genotype: The same as BL21(DE3) except for the additional mutations at 95 UAG codons and disruption of the prfA gene | Vector Backbone:BL21(DE3); Vector Types:; Bacterial Resistance:None | 2026-09-19 02:32:06 | 0 | ||
|
E. coli BL21 (DE3) ΔEntD Resource Report Resource Website |
RRID:Addgene_192874 | The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene. | E.coli | None | PMID:16709676 | EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group. | Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None | 2026-09-19 02:31:26 | 0 | |
|
KI (37)-Oplac2 Resource Report Resource Website |
RRID:Addgene_52704 | KI (37)-Oplac2 strain | None | PMID:22605776 | To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of Oplac2 with those of KIlac, producing and KI(37)-Oplac2. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:20:00 | 0 | ||
|
degtag Resource Report Resource Website |
RRID:Addgene_52705 | degtag strain | None | PMID:22605776 | To generate the degtag strain, we introduced the ssrA tag to the C-terminus of LacZ, thus targeting the protein for degradation by the ClpXP and ClpAP proteases. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:20:00 | 0 | ||
|
KI (37)-Oplac1 Resource Report Resource Website |
RRID:Addgene_52703 | KI (37)-Oplac1 strain | None | PMID:22605776 | To test whether the mRNA secondary structure of our codon redesigned sequences affected expression, we substituted the first 37 nucleotides of OpLac1 with those of KIlac. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:20:00 | 0 | ||
|
OpLac2-delta-6 Resource Report Resource Website |
RRID:Addgene_52700 | OpLac2-Δ6 strain | None | PMID:22605776 | Oplac2Δ6 was erroneously synthesized missing the first 6 nucleotides of Oplac2. These deletions correspond to the first 2 N-terminal amino acid residues (Methionine and Threonine), and instead begin at the Methionine at position 3. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2026-09-19 02:20:00 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.