Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

790 Results - per page

Show More Columns | Download 790 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pORTMAGE502B
 
Resource Report
Resource Website 		RRID:Addgene_128971 PapRecT P. aeruginosa Gentamicin Backbone Size:4000; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:08:35 0
pACEBac1-ZZ-TEV-MZT2-3C-mEGFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178074 MZT2A Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 3
pACEBac1-GCP5
 
Resource Report
Resource Website 		RRID:Addgene_178071 GCP5 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pACEBac1-GCP6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_178072 GCP6 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 1
pACEBac1-gamma-tubulin(N229A)-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178077 gamma-tubulin with an N229A point mutation Homo sapiens Gentamicin PMID:33496729 Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin Changed Asparagine 229 to Alanine 2026-09-19 02:14:39 0
pACEBac1-MZT1
 
Resource Report
Resource Website 		RRID:Addgene_178075 MZT1 Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pACEBac1-beta-actin
 
Resource Report
Resource Website 		RRID:Addgene_178076 beta-actin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pACEBac1-gamma-tubulin-TEV-His6
 
Resource Report
Resource Website 		RRID:Addgene_178067 gamma-tubulin Homo sapiens Gentamicin PMID:33496729 Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:39 0
pCas3cRh
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_133773 RhaR Gentamicin PMID:33077967 Please note: Plasmid contains a K244R mutation in pRO1600 Rep. This mutation is not known to affect plasmid function. Backbone Marker:Dongru Qiu, Hongwei D. Yu; Backbone Size:5216; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:14 3
pDK521
 
Resource Report
Resource Website 		RRID:Addgene_134204 Astrin 1-693-sGFP-His BroAstrin and LC8 and AltSKAP in pACE1 Homo sapiens Gentamicin PMID:28841134 Vector Backbone:pACEBAC1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pDK580
 
Resource Report
Resource Website 		RRID:Addgene_134205 CENP-L and His-CENP-N Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBAC1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pKM377
 
Resource Report
Resource Website 		RRID:Addgene_134210 CENP-H/K/M untagged + his-I Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pKM394
 
Resource Report
Resource Website 		RRID:Addgene_134211 CENP-N-his-CENP-L Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pKM634
 
Resource Report
Resource Website 		RRID:Addgene_134219 CENP HIKM Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pKM672
 
Resource Report
Resource Website 		RRID:Addgene_134221 GST-CENP-C 1-509 Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pKM673
 
Resource Report
Resource Website 		RRID:Addgene_134222 GST-CENP-C 510-end Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pKM692
 
Resource Report
Resource Website 		RRID:Addgene_134224 GST-CENP-C 235-509 Homo sapiens Gentamicin PMID:26698661 Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:09:17 0
pMT85_P438-mEOS3.2_GentaR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_173894 mEos3.2 Lobophyllia hemprichii Gentamicin PMID:35638916 Vector Backbone:pMT85-2res; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:04 1
pMT85_PS-mEos3.2_GentaR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_173895 mEos3.2 Lobophyllia hemprichii Gentamicin PMID:35638916 Vector Backbone:pMT85-2res; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2026-09-19 02:14:04 1
pDONR207 SARS-CoV2 TEV-NSP3
 
Resource Report
Resource Website 		RRID:Addgene_154402 NSP3 SARS-CoV-2 isolate Wuhan-Hu-1 Gentamicin PMID:32763951 Backbone Marker:Rual et al, Genome Res. 14:2128-2135, 2004.; Backbone Size:5005; Vector Backbone:pDONR207; Vector Types:Gateway-compatible Entry vector, with insert of NSP3 CDS with a TEV sequence at the N-term.; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2026-09-19 02:11:23 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the ASWG Community.

Recent News Entries

Is the future of peer review automated?

Automated screening of COVID-19 preprints: can we help authors to improve transparency and reproducibility?

rTransparent

Contact Us

Our Information

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch