Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25759 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25755 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI site.
Proper citation: RRID:Addgene_25757 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25752 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE
Proper citation: RRID:Addgene_25751 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven GFP
Proper citation: RRID:Addgene_25767 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
Proper citation: RRID:Addgene_25763 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25762 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25765 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25764 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25760 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25749 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4608; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25748 Copy
Genetic Insert: Lifeact-Citrine
Vector Backbone Description: Vector Backbone:pDONR207; Vector Types:; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27703856
Proper citation: RRID:Addgene_100590 Copy
Species: Mus musculus
Genetic Insert: mTalin
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Repoter plasmid; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27703856
Proper citation: RRID:Addgene_100591 Copy
Species: Marchantia polymorpha
Genetic Insert: MpPHOT
Vector Backbone Description: Vector Backbone:pDONR207; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:27027881
Proper citation: RRID:Addgene_100600 Copy
Species: Synthetic
Genetic Insert: LRP6 Signal peptide, MCS linker, Twin-Strep tag
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29143175
Proper citation: RRID:Addgene_101652 Copy
Species: Synthetic
Genetic Insert: LRP6 Signal peptide, MCS linker, 3xFLAG tag
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29143175
Proper citation: RRID:Addgene_101653 Copy
Species: Synthetic
Genetic Insert: LRP6 Signal peptide, KpnI linker, 3xFLAG tag
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29143175
Proper citation: RRID:Addgene_101654 Copy
Species: S. elongatus PCC7942
Genetic Insert: RpaA D53A with p0050 promoter (+ gentamicin resistance casette)
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pBR322; Vector Types:Cloning vector; Bacterial Resistance:Gentamicin
Defining Citation: PMID:28430105
Proper citation: RRID:Addgene_101831 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.