Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 1 showing 1 ~ 20 out of 790 results
Snippet view Table view Download 790 Result(s)

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_128971

http://www.addgene.org/128971

Species: P. aeruginosa
Genetic Insert: PapRecT
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin

Proper citation: RRID:Addgene_128971 Copy   

http://www.addgene.org/178074

Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178074 Copy   

    • RRID:Addgene_178071

http://www.addgene.org/178071

Species: Homo sapiens
Genetic Insert: GCP5
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178071 Copy   

    • RRID:Addgene_178072

    This resource has 1+ mentions.

http://www.addgene.org/178072

Species: Homo sapiens
Genetic Insert: GCP6
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178072 Copy   

http://www.addgene.org/178077

Species: Homo sapiens
Genetic Insert: gamma-tubulin with an N229A point mutation
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729
Comments: Primers used to generate pACEBac1-gamma-tubulin(N229A)-TEV-His6 via site-directed mutagenesis were CCCATCCTTCTCCCAGATCGCCCAGCTGGTGTCTACCATCATGTC and GACATGATGGTAGACACCAGCTGGGCGATCTGGGAGAAGGATGGG

Proper citation: RRID:Addgene_178077 Copy   

    • RRID:Addgene_178075

http://www.addgene.org/178075

Species: Homo sapiens
Genetic Insert: MZT1
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178075 Copy   

    • RRID:Addgene_178076

http://www.addgene.org/178076

Species: Homo sapiens
Genetic Insert: beta-actin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178076 Copy   

http://www.addgene.org/178067

Species: Homo sapiens
Genetic Insert: gamma-tubulin
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33496729

Proper citation: RRID:Addgene_178067 Copy   

    • RRID:Addgene_133773

    This resource has 1+ mentions.

http://www.addgene.org/133773

Genetic Insert: RhaR
Vector Backbone Description: Backbone Marker:Dongru Qiu, Hongwei D. Yu; Backbone Size:5216; Vector Backbone:pHERD30T; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:33077967
Comments: Please note: Plasmid contains a K244R mutation in pRO1600 Rep. This mutation is not known to affect plasmid function.

Proper citation: RRID:Addgene_133773 Copy   

    • RRID:Addgene_134204

http://www.addgene.org/134204

Species: Homo sapiens
Genetic Insert: Astrin 1-693-sGFP-His BroAstrin and LC8 and AltSKAP in pACE1
Vector Backbone Description: Vector Backbone:pACEBAC1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:28841134

Proper citation: RRID:Addgene_134204 Copy   

    • RRID:Addgene_134205

http://www.addgene.org/134205

Species: Homo sapiens
Genetic Insert: CENP-L and His-CENP-N
Vector Backbone Description: Vector Backbone:pACEBAC1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134205 Copy   

    • RRID:Addgene_134210

http://www.addgene.org/134210

Species: Homo sapiens
Genetic Insert: CENP-H/K/M untagged + his-I
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134210 Copy   

    • RRID:Addgene_134211

http://www.addgene.org/134211

Species: Homo sapiens
Genetic Insert: CENP-N-his-CENP-L
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134211 Copy   

    • RRID:Addgene_134219

http://www.addgene.org/134219

Species: Homo sapiens
Genetic Insert: CENP HIKM
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134219 Copy   

    • RRID:Addgene_134221

http://www.addgene.org/134221

Species: Homo sapiens
Genetic Insert: GST-CENP-C 1-509
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134221 Copy   

    • RRID:Addgene_134222

http://www.addgene.org/134222

Species: Homo sapiens
Genetic Insert: GST-CENP-C 510-end
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134222 Copy   

    • RRID:Addgene_134224

http://www.addgene.org/134224

Species: Homo sapiens
Genetic Insert: GST-CENP-C 235-509
Vector Backbone Description: Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:26698661

Proper citation: RRID:Addgene_134224 Copy   

    • RRID:Addgene_173894

    This resource has 1+ mentions.

http://www.addgene.org/173894

Species: Lobophyllia hemprichii
Genetic Insert: mEos3.2
Vector Backbone Description: Vector Backbone:pMT85-2res; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35638916

Proper citation: RRID:Addgene_173894 Copy   

    • RRID:Addgene_173895

    This resource has 1+ mentions.

http://www.addgene.org/173895

Species: Lobophyllia hemprichii
Genetic Insert: mEos3.2
Vector Backbone Description: Vector Backbone:pMT85-2res; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:35638916

Proper citation: RRID:Addgene_173895 Copy   

http://www.addgene.org/154402

Species: SARS-CoV-2 isolate Wuhan-Hu-1
Genetic Insert: NSP3
Vector Backbone Description: Backbone Marker:Rual et al, Genome Res. 14:2128-2135, 2004.; Backbone Size:5005; Vector Backbone:pDONR207; Vector Types:Gateway-compatible Entry vector, with insert of NSP3 CDS with a TEV sequence at the N-term.; Bacterial Resistance:Gentamicin
Defining Citation: PMID:32763951

Proper citation: RRID:Addgene_154402 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. ScreenIT Resources

    Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within ASWG that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the ASWG Community.

Recent News Entries

Is the future of peer review automated?

Automated screening of COVID-19 preprints: can we help authors to improve transparency and reproducibility?

rTransparent

Contact Us

Our Information

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch