Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
The Antibody Registry is the authoritative source for antibody identifiers, which can be used in publications to uniquely mark the antibodies used in a paper.
http://antibodyregistry.org/AB_2811107
Comments: Applications: ICC/IF, IHC-frozen, IHC-paraffin, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Synaptopodin
Proper citation: Progen Cat# GP94-IN, RRID:AB_2811107 Copy
http://antibodyregistry.org/AB_2934326
Comments: "Immunization and 4 boost injections in guinea pig; antibody was affinity purified with the immunizing peptide and then validated on mouse taste tissue by blocking with cognate peptide; also shows band of appropriate size on a Western blot. Shows immunoreactivity with appropriate population of taste bud cells in both mouse and human tissue fixed with paraformaldehyde."
Host Organism: guinea pig
Clonality: polyclonal
Target(s): PLCbeta2 (PLCB2)
Proper citation: Thomas Finger - University of Colorado Cat# PLCbeta2 Blue AP, RRID:AB_2934326 Copy
http://antibodyregistry.org/AB_2934262
Comments: Applications: IF/IHC-Fr
Host Organism: guinea pig
Clonality: polyclonal
Target(s): TBR2
Proper citation: Oasis Biofarm Cat# OB-PGP022, RRID:AB_2934262 Copy
http://antibodyregistry.org/AB_2934260
Comments: Applications: IF/IHC-Fr
Host Organism: guinea pig
Clonality: polyclonal
Target(s): neurophysin I
Proper citation: Oasis Biofarm Cat# OB-PGP033, RRID:AB_2934260 Copy
http://antibodyregistry.org/AB_2934253
Comments: Applications: IF/IHC-Fr, IHC-P
Host Organism: guinea pig
Clonality: polyclonal
Target(s): IBA1
Proper citation: Oasis Biofarm Cat# OB-PGP049, RRID:AB_2934253 Copy
http://antibodyregistry.org/AB_2934234
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Rbfox3
Proper citation: Oasis Biofarm Cat# OB-PGP006, RRID:AB_2934234 Copy
http://antibodyregistry.org/AB_2934228
Host Organism: guinea pig
Clonality: polyclonal
Target(s): GFP, eGFP, eYFP, eCFP, eBFP, pHluorin2, Venus
Proper citation: Oasis Biofarm Cat# OB-PGP007, RRID:AB_2934228 Copy
http://antibodyregistry.org/AB_2934239
Comments: Applications: IF/IHC
Host Organism: guinea pig
Clonality: polyclonal
Target(s): mCherry, tdTomato, mRFP1, DsRed, mScarlet, mPlum, mStrawberry, mOrange, mHoneydew, mBanana
Proper citation: Oasis Biofarm Cat# OB-PGP004, RRID:AB_2934239 Copy
http://antibodyregistry.org/AB_2927388
Comments: WB; ICC; IHC; FFPE (IHC-P)
Host Organism: guinea pig
Clonality: recombinant monoclonal
Target(s): Bassoon
Proper citation: Synaptic Systems Cat# 141 318, RRID:AB_2927388 Copy
http://antibodyregistry.org/AB_2927386
Comments: IHC; FFPE (IHC-P)
Host Organism: guinea pig
Clonality: recombinant monoclonal
Target(s): norepinephrine ransporter
Proper citation: Synaptic Systems Cat# 260 308, RRID:AB_2927386 Copy
http://antibodyregistry.org/AB_2921270
Comments: Tamamaki et a., 2000. Neurons in Golgi-stain-like images revealed by GFP-adenovirus infection in vivo. Neurosci Res 38:231– 236: "For the production of anti-GFP antibodies, the full coding sequence of GFP was amplified by polymerase chain reaction (PCR) by using the pGG16 as a template. The sequences of the primers used for the PCR were ATGGTGAGCAAGGGCGAGGA and CTTGTACAGCTCGTCCATGC. The blunt-ended PCR product was cloned into pGEX-4T2 (Amersham-Pharmacia Biotech, USA) at the SmaI site, and glutathioneS-transferase(GST)-GFP fusion protein was induced in E. coli by adding isopropyl-1-thio-beta-D-galactopyranoside (IPTG) to the medium. GFP was purified according to the protocol recommended by the manufacturer of the GST-system (Amersham-Pharmacia Biotech, USA). The purified GFP was emulsified with Freund’s complete adjuvant (Difco, USA; Johnstone and Thorpe, 1987), and injected intracutaneously into female rabbits (2 mg/animal) and guinea pigs (0.5 mg/animal). Four weeks after the immunization, the same amount of GFP emulsified with incomplete Freund’s adjuvant was injected into the animals. The sera were recovered 10–20 days after the second immunization. Antibodies were further affinity-purified with GFP-conjugated Affigel 10 gel (BioRad, USA); (2 mg GFP/1 ml gel). After 25 mg of crude g-globulin fraction was applied to 1 ml of the antigen column, the specific antibodies were eluted with 0.1 M glycine-HCl, pH2.5."
Host Organism: guinea pig
Clonality: polyclonal
Target(s): artificial protein
Proper citation: Takeshi Kaneko - Kyoto University Cat# eGFP1, RRID:AB_2921270 Copy
http://antibodyregistry.org/AB_2920670
Comments: Application: ICC/IF, IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Synaptopodin/SYNPO
Proper citation: Progen Cat# GP94-N, RRID:AB_2920670 Copy
http://antibodyregistry.org/AB_2920693
Comments: Application: IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Keratin K75
Proper citation: Progen Cat# GP-K6HF, RRID:AB_2920693 Copy
http://antibodyregistry.org/AB_2920673
Comments: Application: ICC/IF, IHC, WB
Host Organism: guinea pig
Clonality: unknown
Target(s): keratins
Proper citation: Progen Cat# GP14, RRID:AB_2920673 Copy
http://antibodyregistry.org/AB_2920669
Comments: Application: IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): K14
Proper citation: Progen Cat# GP-CK14, RRID:AB_2920669 Copy
http://antibodyregistry.org/AB_2920821
Host Organism: guinea pig
Clonality: unknown
Target(s): CYP17A1
Proper citation: K. Nishimoto, Department of Uro-Oncology, Saitama Medical University International Medical Center Cat# Nishimoto_CYP17A1, RRID:AB_2920821 Copy
http://antibodyregistry.org/AB_2920679
Comments: Application: IHC, WB
Host Organism: guinea pig
Clonality: polyclonal
Target(s): keratin K5
Proper citation: Progen Cat# GP-CK5, RRID:AB_2920679 Copy
http://antibodyregistry.org/AB_2924931
Comments: WB, ICC; FFPE (IHC-P)
Host Organism: guinea pig
Clonality: recombinant monoclonal
Target(s): SNAP 25
Proper citation: Synaptic Systems Cat# 111 308, RRID:AB_2924931 Copy
http://antibodyregistry.org/AB_2924959
Comments: WB; ICC; IHC; FFPE (IHC-P)
Host Organism: guinea pig
Clonality: recombinant monoclonal
Target(s): Synaptophysin 1
Proper citation: Synaptic Systems Cat# 101 308, RRID:AB_2924959 Copy
http://antibodyregistry.org/AB_2924939
Comments: WB; ICC
Host Organism: guinea pig
Clonality: polyclonal
Target(s): Homer 1
Proper citation: Synaptic Systems Cat# 160 005, RRID:AB_2924939 Copy
Can't find your Antibody?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific antibody, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your antibody in the search results, please help us by registering it into the system — it's easy. Register it with The Antibody Registry (an Antibody Registry account is required. Create a free Antibody Registry account if you don't have one yet). An RRID will be generated in 1-2 business days.
Welcome to the ASWG Resources search. From here you can search through a compilation of resources used by ASWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that ASWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on ASWG then you can log in from here to get additional features in ASWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into ASWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within ASWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the ASWG Community.
Our Information
