Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00050765
Proper Citation: RRID:WB-STRAIN:WBStrain00050765
Description: Caenorhabditis elegans with name che-1(luc174) I. from WB.
Species: Caenorhabditis elegans
Synonyms: che-1(luc174) I.
Notes: Made_by: Julien Charest|"Wild-type morphology. CRISPR/Cas9 engineered 3.38 kB deletion of the che-1 locus. Flank: caaaaacatcacaaaaataa"
Affected Gene: WBGene00000483(che-1)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for che-1(luc174) I..
No alerts have been found for che-1(luc174) I..
Source: Integrated Animals
Source Database: WormBase (WB)
Welcome to the ASWG Community.
Our Information
