Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00037928
Proper Citation: RRID:WB-STRAIN:WBStrain00037928
Description: Caenorhabditis elegans with name Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III. from WB.
Species: Caenorhabditis elegans
Synonyms: Y39G10AR.15(gk5206) ZC334.7(gk5207) I; cnnm-5(gk5208) III.
Notes: Homozygous viable. Nonsense and splicing alleles identified by amplicon sequencing. The gk5206 mutation is T->A, flanking sequences GGCCTTTCCAACTTAGAATTTTGGTCGTCC and GAAAAATAACGAAGTTATGGTGAACTCCCT. The gk5207 mutation is C->T, flanking sequences CCTGAGATCAAATGTACAAATTTTCAGGCC and GACGCTACCCGGTAATGATGTACACCCTGA. The gk5208 mutation is T->A, flanking sequences CAATCGTGATGATTCCGACTACTTTCGAGC and GAAATTTGGTGAAACTTTAGGGCTACAATG.|"Made_by: Vancouver KO Group"
Affected Gene: WBGene00011260(cnnm-5)|WBGene00013865(ZC334.7)|WBGene00021471(Y39G10AR.15)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for VC4126.
No alerts have been found for VC4126.
Source: Integrated Animals
Source Database: WormBase (WB)
Welcome to the ASWG Community.
Our Information
