Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00028776
Proper Citation: RRID:WB-STRAIN:WBStrain00028776
Description: Caenorhabditis elegans with name F54A5.3a(ok198) I. from WB.
Species: Caenorhabditis elegans
Synonyms: F54A5.3a(ok198) I.
Notes: Mutagen:UV/TMP|"No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3."
Affected Gene: WBGene00018788(shc-1)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for NH3119.
No alerts have been found for NH3119.
Source: Integrated Animals
Source Database: WormBase (WB)
Welcome to the ASWG Community.
Our Information
