URL: http://www.addgene.org/48286
Proper Citation: RRID:Addgene_48286
Bacterial Resistance: Ampicillin
Defining Citation: PMID:
Vector Backbone Description: Backbone Size:5929; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-MBP fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET His6 MBP TEV cloning vector with BioBrick polycistronic restriction sites (9C).
No alerts have been found for pET His6 MBP TEV cloning vector with BioBrick polycistronic restriction sites (9C).
Source: Addgene
