URL: http://www.addgene.org/68716
Proper Citation: RRID:Addgene_68716
Insert Name: bsr
Organism: Other
Bacterial Resistance: Ampicillin
Defining Citation: PMID:26116467
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pQCXIP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Overall this plasmid contains bsr-GFP11-ires-puromycin resistance gene. GFP11 covers the 11th strand of GFP and the sequence is ctgcagcgcgatcacatggtcctgcacgagtacgtgaacgccgccgggatcact.
Expand AllWe found {{ ctrl2.mentions.total_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pQCXIP-BSR-GFP11.
No alerts have been found for pQCXIP-BSR-GFP11.
Source: Addgene