Waardenburg syndrome is an uncommon genetic condition characterized by at least some degree of congenital hearing loss and pigmentation deficiencies. However, the genetic pathway affecting the development of stria vascularis is not fully illustrated.

The present study aimed to investigate the molecular pathology of Waardenburg syndrome type II in three families, in order to provide genetic diagnosis and hereditary counseling for family members. Relevant clinical examinations were conducted on the probands of the three pedigrees. Peripheral blood samples of the probands and related family members were collected and genomic DNA was extracted. The coding sequences of paired box 3 (PAX3), microphthalmia‑associated transcription factor (MITF), sex‑determining region Y‑box 10 (SOX10) and snail family zinc finger 2 (SNAI2) were analyzed by polymerase chain reaction and DNA sequencing. The heterozygous mutation, c.649_651delAGA in exon 7 of the MITF gene was detected in the proband and all patients of pedigree 1; however, no pathological mutation of the relevant genes (MITF, SNAI2, SOX10 or PAX3) was detected in pedigrees 2 and 3. The heterozygous mutation c.649_651delAGA in exon 7 of the MITF gene is therefore considered the disease‑causing mutation in pedigree 1. However, there are novel disease‑causing genes in Waardenburg syndrome type II, which require further research.

Waardenburg syndrome (WS) is a dominantly inherited, genetically heterogeneous auditory-pigmentary syndrome characterized by non-progressive sensorineural hearing loss and iris discoloration. By whole-exome sequencing (WES), we identified a nonsense mutation (c.598C>T) in PAX3 gene, predicted to be disease causing by in silico analysis. This is the first report of genetically diagnosed case of WS PAX3 c.598C>T nonsense mutation in Chinese ethnic origin by WES and in silico functional prediction methods.

Waardenburg syndrome (WS) is a rare auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and pigmentation defects. Four subtypes are clinically defined based on the presence or absence of additional symptoms. WS type 2 (WS2) can result from mutations within the MITF or SOX10 genes; however, 70% of WS2 cases remain unexplained at the molecular level, suggesting that other genes might be involved and/or that mutations within the known genes escaped previous screenings. The recent identification of a deletion encompassing three of the SOX10 regulatory elements in a patient presenting with another WS subtype, WS4, defined by its association with Hirschsprung disease, led us to search for deletions and point mutations within the MITF and SOX10 regulatory elements in 28 yet unexplained WS2 cases. Two nucleotide variations were identified: one in close proximity to the MITF distal enhancer (MDE) and one within the U1 SOX10 enhancer. Functional analyses argued against a pathogenic effect of these variations, suggesting that mutations within regulatory elements of WS genes are not a major cause of this neurocristopathy.

MITF mutations results in an abnormal melanocyte development and lead to Waardenburg syndrome type 2 (WS2). Here, we analyzed the in vitro activities of two recently identified WS2-associated MITF mutations (p.R217I and p.T192fsX18). The R217I MITF retained partial activity, normal DNA-binding ability and nuclear distribution, whereas the T192fsX18 MITF failed to activate TYR promoter and showed aberrant subcellular localization which may be caused by deletion of nuclear localization signal (NLS) at aa 213-218 (ERRRRF). These results suggest that haploinsufficiency may be the underlying mechanism for the mild phenotypes of WS2 caused by these two mutations.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

The purpose of this study is to profile the clinical and genetic features of Japanese Waardenburg syndrome (WS) patients and validate the W index. Sixteen Japanese WS families with congenital sensorineural hearing loss were included in the study. The inner canthal, interpupillary, and outer canthal distances (ICD, IPD, and OCD) were measured for all patients, and patients were screened for presence of PAX3, MITF, SOX10, and EDNRB mutations. The WS patients were clinically classified under the current W index as follows: 13 families with WS1, 2 families with WS2, and 1 family with WS4. In the 13 WS1 families, genetic tests found PAX3 mutations in 5 families, MITF mutations in 4 families, SOX10 mutations in 3 families, and EDNRB mutations in 1 family. 61% of clinically classified WS1 patients under the current W index conflicted with the genetic classification, which implies W index is not appropriate for Japanese population. Resetting the threshold of W index or novel index formulated with ethnicity matched samples is necessary for clinical classification which is consistent with genetic classification for WS patients with distinct ethnicity.

Waardenburg Syndrome (WS) is an autosomal-dominant disorder characterized by sensorineural hearing loss and pigmentary abnormalities of the eyes, hair, and skin. Microphthalmia-associated transcription factor (MITF) gene mutations account for about 15% of WS type II (WS2) cases. To date, fewer than 40 different MITF gene mutations have been identified in human WS2 patients, and few of these were of Chinese descent. In this study, we report clinical findings and mutation identification in the MITF gene of 20 Chinese WS2 patients from 14 families. A high level of clinical variability was identified. Sensorineural hearing loss (17/20, 85.0%) and heterochromia iridum (20/20, 100.0%) were the most commonly observed clinical features in Chinese WS2 patients. Five affected individuals (5/20, 25.0%) had numerous brown freckles on the face, trunk, and limb extremities. Mutation screening of the MITF gene identified five mutations: c.20A>G, c.332C>T, c.647_649delGAA, c.649A>G, and c.763C>T. The total mutational frequency of the MITF gene was 21.4% (3/14), which is significantly higher than the 15.0% observed in the fair-skinned WS2 population. Our results indicate that MITF mutations are relatively common among Chinese WS2 patients.

To detect paired box gene 3 (PAX3) mutations and associated phenotypes in Chinese patients with Waardenburg syndrome type 1 (WS1).

Waardenburg syndrome (WS) is an auditory-pigmentary disorder that exhibits varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair and skin. Depending on additional symptoms, WS is classified into four subtypes, WS1-WS4. Absence of additional features characterizes WS2. The association of facial dysmorphic features defines WS1 and WS3, whereas the association with Hirschsprung disease (aganglionic megacolon) characterizes WS4, also called "Waardenburg-Hirschsprung disease." Mutations within the genes MITF and SNAI2 have been identified in WS2, whereas mutations of EDN3, EDNRB, and SOX10 have been observed in patients with WS4. However, not all cases are explained at the molecular level, which raises the possibility that other genes are involved or that some mutations within the known genes are not detected by commonly used genotyping methods. We used a combination of semiquantitative fluorescent multiplex polymerase chain reaction and fluorescent in situ hybridization to search for SOX10 heterozygous deletions. We describe the first characterization of SOX10 deletions in patients presenting with WS4. We also found SOX10 deletions in WS2 cases, making SOX10 a new gene of WS2. Interestingly, neurological phenotypes reminiscent of that observed in WS4 (PCWH syndrome [peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung disease]) were observed in some WS2-affected patients with SOX10 deletions. This study further characterizes the molecular complexity and the close relationship that links the different subtypes of WS.

Waardenburg syndrome (WS) is a rare genetic disorder characterized by varying degrees of sensorineural hearing loss and accumulated pigmentation in the skin, hair and iris. The syndrome is classified into four types (WS1, WS2, WS3, and WS4), each with different clinical phenotypes and underlying genetic causes. The aim of this study was to identify the pathogenic variant in a Chinese family with Waardenburg syndrome type IV.

Waardenburg syndrome (WS) is a group of rare genetic disorders characterized by hearing loss, changes in coloring of hair, skin, and eyes, and alterations in the shape of the face. Tietz syndrome is another rare disorder which presented similar phenotypes to WS. Patients with Tietz/Waardenburg syndrome often present with pale blue eyes, albino skin, and distinctive hair coloring, such as a patch of white hair or hair that prematurely turns gray. At present, more than six candidate genes are responsible for four types of Waardenburg syndrome and Tietz syndrome. This study is aimed at identifying the pathogenic gene variants in a three-generation Han Chinese family with hearing loss, blue-gray iris, albino skin, and white hair. In order to discover the molecular genetic lesion underlying the disease phenotype, whole exome sequencing in the proband, with Tietz/Waardenburg syndrome phenotypes, of a Han Chinese family from HeBei, China, was conducted. A novel heterozygous c.650G>C/p.Arg217Thr variant in melanocyte inducing transcription factor (MITF) was identified. Sanger sequencing further validated that this mutation existed in three affected individuals and absent in healthy family members. Bioinformatics analysis predicted that this mutation was deleterious. Our study further identified the genetic lesion of the family. Simultaneously, our study may also contribute to genetic counseling, embryonic screening of in vitro fertilized embryos, and prenatal genetic diagnosis of patients with Tietz/Waardenburg syndrome, especially for the proband, unmarried and unpregnant women, to reduce familial transmission in this Han Chinese family.

Waardenburg syndrome (WS) is a rare autosomal-dominant syndrome and is characterized by sensorineural hearing loss and pigment abnormalities. It is subdivided into four types according to the clinical characteristics. MITF is one of the major pathogenic genes for type II. The aim of this study was to investigate MITF mutations and the clinical characteristics of WS type 2 (WS2) in four Chinese families.

Waardenburg syndrome (WS) is a dominantly inherited, genetically heterogeneous auditory-pigmentary syndrome characterized by nonprogressive sensorineural hearing loss and iris discoloration. This study aimed to investigate the underlying molecular pathology in Chinese WS families.

This study aimed to explore the genetic causes of probands who were diagnosed with Waardenburg syndrome (WS) or congenital sensorineural hearing loss.

Waardenburg syndrome (WS), also known as auditory-pigmentary syndrome, is the most common cause of syndromic hearing loss. It is responsible for 2-5% of congenital deafness. WS is classified into four types depending on the clinical phenotypes. Currently, pathogenic mutation of PAX3, MITF, EDNRB, EDN3, SNAI2, or SOX10 can cause corresponding types of WS. Among them, SOX10 mutation is responsible for approximately 15% of type II WS or 50% of type IV WS. We report the case of a proband in a Chinese family who was diagnosed with WS type II. Whole exome sequencing (WES) of the proband detected a novel heterozygous spontaneous mutation: SOX10 c.246delC. According to analysis based on nucleic acid and amino acid sequences, this mutation may produce a truncated protein, with loss of the HMG structure domain. Therefore, this truncated protein may fail to activate the expression of the MITF gene, which regulates melanocytic development and plays a key role in WS. Our finding expands the database of SOX10 mutations associated with WS and provides more information regarding the molecular mechanism of WS.

Waardenburg syndrome is an autosomal dominant inherited syndromic hereditary hearing loss characterized by varying combinations of sensorineural hearing loss and abnormal pigmentation of the hair, skin, and inner ear. The aim of this study was to analyze the clinical phenotypes and genetic variants of a Chinese boy with Waardenburg syndrome type 2 and to explore the possible molecular pathogenesis of Waardenburg syndrome type 2. Clinical, audiological, and ophthalmologic evaluations were performed on the proband. Clinical data from the principal members in the proband's family were collected through questionnaires. Genetic analysis was conducted, including targeted next-generation sequencing of 144 known deafness genes, Sanger sequencing, and bioinformatic analysis. Waardenburg syndrome type 2was diagnosed in a 4-year-old boy according to the Waardenburg Syndrome Consortium Criteria. The novel missense mutation c.426G>T (p.Trp142Cys) was identified in SOX10 in the proband but was absent in his parents and the controls. A de novo missense mutation in SOX10 was the genetic cause of Waardenburg syndrome type 2 in the proband, which was useful for the molecular diagnosis of Waardenburg syndrome type 2.

The objective of this study was to investigate the genetic causes of two probands diagnosed as Waardenburg syndrome (WS type I and IV) from two unrelated Chinese families.

The characteristics of Waardenburg syndrome (WS) as a scarce heritable disorder are sensorineural hearing loss and deficits of pigmentation in the skin, hair, and eye. Here, clinical features and detection of the mutation in the MITF gene of WS2 patients are reported in a sizable Iranian family.

Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome.