Sequence-specific DNA binding recruits transcription factors (TFs) to the genome to regulate gene expression. Here, we perform high resolution mapping of CEBP proteins to determine how sequence dictates genomic occupancy. We demonstrate a fundamental difference between the sequence repertoire utilized by CEBPs in vivo versus the palindromic sequence preference reported by classical in vitro models, by identifying a palindromic motif at <1% of the genomic binding sites. On the native genome, CEBPs bind a diversity of related 10 bp sequences resulting from the fusion of degenerate and canonical half-sites. Altered DNA specificity of CEBPs in cells occurs through heterodimerization with other bZip TFs, and approximately 40% of CEBP-binding sites in primary human cells harbor motifs characteristic of CEBP heterodimers. In addition, we uncover an important role for sequence bias at core-motif-flanking bases for CEBPs and demonstrate that flanking bases regulate motif function across mammalian bZip TFs. Favorable flanking bases confer efficient TF occupancy and transcriptional activity, and DNA shape may explain how the flanks alter TF binding. Importantly, motif optimization within the 10-mer is strongly correlated with cell-type-independent recruitment of CEBPβ, providing key insight into how sequence sub-optimization affects genomic occupancy of widely expressed CEBPs across cell types.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

The protein kinase Gcn2 is a central transducer of nutritional stress signaling important for stress adaptation by normal cells and the survival of cancer cells. In response to nutrient deprivation, Gcn2 phosphorylates eIF2α, thereby repressing general translation while enhancing translation of specific mRNAs with upstream ORFs (uORFs) situated in their 5'-leader regions. Here we performed genome-wide measurements of mRNA translation during histidine starvation in fission yeast Schizosaccharomyces pombe. Polysome analyses were combined with microarray measurements to identify gene transcripts whose translation was up-regulated in response to the stress in a Gcn2-dependent manner. We determined that translation is reprogrammed to enhance RNA metabolism and chromatin regulation and repress ribosome synthesis. Interestingly, translation of intron-containing mRNAs was up-regulated. The products of the regulated genes include additional eIF2α kinase Hri2 amplifying the stress signaling and Gcn5 histone acetyl transferase and transcription factors, together altering genome-wide transcription. Unique dipeptide-coding uORFs and nucleotide motifs, such as '5'-UGA(C/G)GG-3', are found in 5' leader regions of regulated genes and shown to be responsible for translational control.

The pyridine nucleotide disulfide reductase (PNDR) is a large and heterogeneous protein family divided into two classes (I and II), which reflect the divergent evolution of its characteristic disulfide redox active site. However, not all the PNDR members fit into these categories and this suggests the need of further studies to achieve a more comprehensive classification of this complex family.

Guanylate-binding proteins (GBPs) are interferon-inducible GTPases that confer protective immunity against a variety of intracellular pathogens including bacteria, viruses, and protozoan parasites. GBP2 is one of the two highly inducible GBPs, yet the precise mechanisms underlying the activation and regulation of GBP2, in particular the nucleotide-induced conformational changes in GBP2, remain poorly understood. In this study, we elucidate the structural dynamics of GBP2 upon nucleotide binding through crystallographic analysis. GBP2 dimerizes upon GTP hydrolysis and returns to monomer state once GTP is hydrolyzed to GDP. By determining the crystal structures of GBP2 G domain (GBP2GD) in complex with GDP and nucleotide-free full-length GBP2, we unveil distinct conformational states adopted by the nucleotide-binding pocket and distal regions of the protein. Our findings demonstrate that the binding of GDP induces a distinct closed conformation both in the G motifs and the distal regions in the G domain. The conformational changes in the G domain are further transmitted to the C-terminal helical domain, leading to large-scale conformational rearrangements. Through comparative analysis, we identify subtle but critical differences in the nucleotide-bound states of GBP2, providing insights into the molecular basis of its dimer-monomer transition and enzymatic activity. Overall, our study expands the understanding of the nucleotide-induced conformational changes in GBP2, shedding light on the structural dynamics governing its functional versatility. These findings pave the way for future investigations aimed at elucidating the precise molecular mechanisms underlying GBP2's role in the immune response and may facilitate the development of targeted therapeutic strategies against intracellular pathogens.

An analysis of Candida albicans ABC transporters identified conserved related α-helical sequence motifs immediately C-terminal of each Walker A sequence. Despite the occurrence of these motifs in ABC subfamilies of other yeasts and higher eukaryotes, their roles in protein function remained unexplored. In this study we have examined the functional significance of these motifs in the C. albicans PDR transporter Cdr1p. The motifs present in NBD1 and NBD2 were subjected to alanine scanning mutagenesis, deletion, or replacement of an entire motif. Systematic replacement of individual motif residues with alanine did not affect the function of Cdr1p but deletion of the M1-motif in NBD1 (M1-Del) resulted in Cdr1p being trapped within the endoplasmic reticulum. In contrast, deletion of the M2-motif in NBD2 (M2-Del) yielded a non-functional protein with normal plasma membrane localization. Replacement of the motif in M1-Del with six alanines (M1-Ala) significantly improved localization of the protein and partially restored function. Conversely, replacement of the motif in M2-Del with six alanines (M2-Ala) did not reverse the phenotype and susceptibility to antifungal substrates of Cdr1p was unchanged. Together, the M1 and M2 motifs contribute to the functional asymmetry of NBDs and are important for maturation of Cdr1p and ATP catalysis, respectively.

Previously, cooperative binding of the bZIP domain of CREB1 and the ETS domain of GABPα was observed for the composite DNA ETS ⇔ CRE motif (A 0 C 1 C 2 G 3 G 4 A 5 A 6 G 7 T 8 G 9 A 10 C 11 G 12 T 13 C 14 A 15 ). Single nucleotide polymorphisms (SNPs) at the beginning and end of the ETS motif (ACCGGAAGT) increased cooperative binding. Here, we use an Agilent microarray of 60-mers containing all double nucleotide polymorphisms (DNPs) of the ETS ⇔ CRE motif to explore GABPα and CREB1 binding to their individual motifs and their cooperative binding. For GABPα, all DNPs were bound as if each SNP acted independently. In contrast, CREB1 binding to some DNPs was stronger or weaker than expected, depending on the locations of each SNP. CREB1 binding to DNPs where both SNPs were in the same half site, T 8 G 9 A 10 or T 13 C 14 A 15 , was greater than expected, indicating that an additional SNP cannot destroy binding as much as expected, suggesting that an individual SNP is enough to abolish sequence-specific DNA binding of a single bZIP monomer. If a DNP contains SNPs in each half site, binding is weaker than expected. Similar results were observed for additional ETS and bZIP family members. Cooperative binding between GABPα and CREB1 to the ETS ⇔ CRE motif was weaker than expected except for DNPs containing A 7 and SNPs at the beginning of the ETS motif.

Previous studies have shown that single-nucleotide polymorphisms (SNPs) of a disintegrin and metalloproteinase with thrombospondin type 1 motif 4 (ADAMTS4) may involve in the pathogenesis of some diseases. However, it is not clear whether they are associated with hepatocellular carcinoma (HCC). A hospital-based case-control study, including 862 cases with HCC and 1120 controls, was conducted to assess the effects of 258 SNPs in the coding regions of ADAMTS4 on HCC risk and prognosis. We found that six SNPs in ADAMTS4 were differential distribution between cases and controls via the primary screening analyses; however, only rs538321148 and rs1014509103 polymorphisms were further identified to modify the risk of HCC (odds ratio: 2.73 and 2.95; 95% confidence interval, 2.28-3.29 and 2.43-3.58; P-value, 5.73 × 10-27 and 1.36 × 10-27 , respectively). Significant interaction between these two SNPs and two known causes of hepatitis B virus and aflatoxin B1 were also observed. Furthermore, rs538321148 and rs1014509103 polymorphisms were associated not only with clinicopathological features of tumor such as tumor stage and grade, microvessel density, and vessel metastasis, but with poor overall survival. Additionally, these SNPs significantly downregulated ADATMS4 expression in tumor tissues. These data suggest that SNPs in the coding region of ADAMTS4, such as rs538321148 and rs1014509103, may be potential biomarkers for predicting HCC risk and prognosis.

Elevated sequencing error rates are the most predominant obstacle in single-nucleotide polymorphism (SNP) detection, which is a major goal in the bulk of current studies using next-generation sequencing (NGS). Beyond routinely handled generic sources of errors, certain base calling errors relate to specific sequence patterns. Statistically principled ways to associate sequence patterns with base calling errors have not been previously described. Extant approaches either incur decisive losses in power, due to relating errors with individual genomic positions rather than motifs, or do not properly distinguish between motif-induced and sequence-unspecific sources of errors.

Homologous recombination is a key pathway found in nearly all bacterial taxa. The recombination complex not only allows bacteria to repair DNA double-strand breaks but also promotes adaption through the exchange of DNA between cells. In Proteobacteria, this process is mediated by the RecBCD complex, which relies on the recognition of a DNA motif named Chi to initiate recombination. The Chi motif has been characterized in Escherichia coli and analogous sequences have been found in several other species from diverse families, suggesting that this mode of action is widespread across bacteria. However, the sequences of Chi-like motifs are known for only five bacterial species: E. coli, Haemophilus influenzae, Bacillus subtilis, Lactococcus lactis, and Staphylococcus aureus. In this study, we detected putative Chi motifs in a large dataset of Proteobacteria and identified four additional motifs sharing high sequence similarity and similar properties to the Chi motif of E. coli in 85 species of Proteobacteria. Most Chi motifs were detected in Enterobacteriaceae and this motif appears well conserved in this family. However, we did not detect Chi motifs for the majority of Proteobacteria, suggesting that different motifs are used in these species. Altogether these results substantially expand our knowledge on the evolution of Chi motifs and on the recombination process in bacteria.

Major intrinsic proteins (MIPs) also named aquaporins form channels facilitating the passive transport of water and other small polar molecules across membranes. MIPs are particularly abundant and diverse in terrestrial plants but little is known about their evolutionary history. In an attempt to investigate the origin of the plant MIP subfamilies, genomes of chlorophyte algae, the sister group of charophyte algae and land plants, were searched for MIP encoding genes.

CD4+ T cells use T cell receptor (TCR)-CD3 complexes, and CD4, to respond to peptide antigens within MHCII molecules (pMHCII). We report here that, through ~435 million years of evolution in jawed vertebrates, purifying selection has shaped motifs in the extracellular, transmembrane, and intracellular domains of eutherian CD4 that enhance pMHCII responses, and covary with residues in an intracellular motif that inhibits responses. Importantly, while CD4 interactions with the Src kinase, Lck, are viewed as key to pMHCII responses, our data indicate that CD4-Lck interactions derive their importance from the counterbalancing activity of the inhibitory motif, as well as motifs that direct CD4-Lck pairs to specific membrane compartments. These results have implications for the evolution and function of complex transmembrane receptors and for biomimetic engineering.

We consider the dimensionality of social networks, and develop experiments aimed at predicting that dimension. We find that a social network model with nodes and links sampled from an m-dimensional metric space with power-law distributed influence regions best fits samples from real-world networks when m scales logarithmically with the number of nodes of the network. This supports a logarithmic dimension hypothesis, and we provide evidence with two different social networks, Facebook and LinkedIn. Further, we employ two different methods for confirming the hypothesis: the first uses the distribution of motif counts, and the second exploits the eigenvalue distribution.

Predicting RNA 3D structure from sequence is a major challenge in biophysics. An important sub-goal is accurately identifying recurrent 3D motifs from RNA internal and hairpin loop sequences extracted from secondary structure (2D) diagrams. We have developed and validated new probabilistic models for 3D motif sequences based on hybrid Stochastic Context-Free Grammars and Markov Random Fields (SCFG/MRF). The SCFG/MRF models are constructed using atomic-resolution RNA 3D structures. To parameterize each model, we use all instances of each motif found in the RNA 3D Motif Atlas and annotations of pairwise nucleotide interactions generated by the FR3D software. Isostericity relations between non-Watson-Crick basepairs are used in scoring sequence variants. SCFG techniques model nested pairs and insertions, while MRF ideas handle crossing interactions and base triples. We use test sets of randomly-generated sequences to set acceptance and rejection thresholds for each motif group and thus control the false positive rate. Validation was carried out by comparing results for four motif groups to RMDetect. The software developed for sequence scoring (JAR3D) is structured to automatically incorporate new motifs as they accumulate in the RNA 3D Motif Atlas when new structures are solved and is available free for download.

Epigenetic silencing involving the aberrant methylation of promoter region CpG islands is widely recognized as a tumor suppressor silencing mechanism in cancer. However, the molecular pathways underlying aberrant DNA methylation remain elusive. Recently we showed that, on a genome-wide level, CpG island loci differ in their intrinsic susceptibility to aberrant methylation and that this susceptibility can be predicted based on underlying sequence context. These data suggest that there are sequence/structural features that contribute to the protection from or susceptibility to aberrant methylation. Here we use motif elicitation coupled with classification techniques to identify DNA sequence motifs that selectively define methylation-prone or methylation-resistant CpG islands. Motifs common to 28 methylation-prone or 47 methylation-resistant CpG island-containing genomic fragments were determined using the MEME and MAST algorithms (). The five most discriminatory motifs derived from methylation-prone sequences were found to be associated with CpG islands in general and were nonrandomly distributed throughout the genome. In contrast, the eight most discriminatory motifs derived from the methylation-resistant CpG islands were randomly distributed throughout the genome. Interestingly, this latter group tended to associate with Alu and other repetitive sequences. Used together, the frequency of occurrence of these motifs successfully discriminated methylation-prone and methylation-resistant CpG island groups with an accuracy of 87% after 10-fold cross-validation. The motifs identified here are candidate methylation-targeting or methylation-protection DNA sequences.

Sequence-specific transcription factors (TFs) recognize motifs of related nucleotide sequences at their DNA binding sites. Upon binding at these sites, TFs regulate critical molecular processes such as gene expression. It is widely assumed that a TF recognizes a single "canonical" motif, although recent studies have identified additional "non-canonical" motifs for some TFs. A comprehensive approach to identify non-canonical DNA binding motifs and the functional importance of those motifs' matches in the human genome is necessary for fully understanding the mechanisms of TF-regulated molecular processes in human cells. To address this need, we developed a statistical pipeline for in vitro HT-SELEX data that identifies and characterizes the distributions of non-canonical TF motifs in a stringent manner. Analyzing ~170 human TFs' HT-SELEX data, we found non-canonical motifs for 19 TFs (11%). These non-canonical motifs occur independently of the TFs' canonical motifs. Non-canonical motif occurrences in the human genome show similar evolutionary conservation to canonical motif occurrences, explain TF binding in locations without canonical motifs, and occur within gene promoters and epigenetically marked regulatory sequences in human cell lines and tissues. Our approach and collection of non-canonical motifs expand current understanding of functionally relevant DNA binding sites for human TFs.

Scientists have discovered various prognostic gene signatures (GSs) in different cancer types. Surprisingly, although different GSs from the same cancer type can be used to measure similar biological characteristics, often rarely is there a gene shared by different GSs. To explain such a paradox, we hypothesized that GSs from the same cancer type may be regulated by common regulatory motifs. To test this hypothesis, we carried out a comprehensive motif analysis on the prognostic GSs from five cancer types. We demonstrated that GSs from individual cancer type as well as across cancer types share regulatory motifs. We also observed that transcription factors that likely bind to these shared motifs have prognostic functions in cancers. Moreover, 75% of the predicted cofactors of these transcription factors may have cancer-related functions and some cofactors even have prognostic functions. In addition, there exist common microRNAs that regulate different GSs from individual cancer types and across cancer types, several of which are prognostic biomarkers for the corresponding cancer types. Our study suggested the existence of common regulatory mechanisms shared by GSs from individual cancer types and across cancer types, which shed light on the discovery of new prognostic GSs in cancers and the understanding of the regulatory mechanisms of cancers.

Increasing experimental evidence indicates that short polybasic peptides are able to translocate across the membrane of living cells. However, these peptides, often derived from viruses and insects, may induce unspecific effects that could mask the action of their cargoes. Here, we show that a panel of lysine and/or arginine-rich peptides, derived from human proteins involved in cell signalling pathways leading to inflammation, possess the intrinsic ability to cross intact cellular membranes. These peptides are also capable of carrying a biologically active cargo. One of these peptides, encompassing the cell permeable sequence of the Toll-receptor 4 (TLR4) adaptor protein (TIRAP) and modified to carry a dominant-negative domain of the same TIRAP protein, selectively inhibited the production of pro-inflammatory cytokines upon LPS challenge, in in vitro, ex vivo and in vivo experiments. Docking studies indicated that this inhibition might be mediated by the disruption of the recruitment of downstream effector molecules. These results show for the first time the potential of using for therapy cell permeable peptides derived from human proteins involved in disease.

How the locus-specificity of epigenetic modifications is regulated remains an unanswered question. A contributing mechanism is that epigenetic enzymes are recruited to specific loci by DNA binding factors recognizing particular sequence motifs (referred to as epi-motifs). Using these motifs to predict biological outputs depending on local epigenetic state such as somatic mutation rates would confirm their functionality. Here, we used DNA motifs including known TF motifs and epi-motifs as a surrogate of epigenetic signals to predict somatic mutation rates in 13 cancers at an average 23kbp resolution. We implemented an interpretable neural network model, called contextual regression, to successfully learn the universal relationship between mutations and DNA motifs, and uncovered motifs that are most impactful on the regional mutation rates such as TP53 and epi-motifs associated with H3K9me3. Furthermore, we identified genomic regions with significantly higher mutation rates than the expected values in each individual tumor and demonstrated that such cancer-related regions can accurately predict cancer types. Interestingly, we found that the same mutation signatures often have different contributions to cancer-related and cancer-independent regions, and we also identified the motifs with the most contribution to each mutation signature.

The nucleotide polymorphism in the human mitochondrial genome (mtDNA) tolled by codon position bias plays an indispensable role in human population dispersion and expansion. Herein, genome-wide nucleotide co-occurrence networks were constructed using data comprised of five different geographical regions and around 3000 samples for each region. We developed a powerful network model to describe complex mitochondrial evolutionary patterns among codon and non-codon positions. We found evidence that the evolution of human mitochondria DNA is dominated by adaptive forces, particularly mutation and selection, which was supported by many previous studies. The diversity observed in the mtDNA was compared with mutations, co-occurring mutations, network motifs considering codon positions as causing agent. This comparison showed that long-range nucleotide co-occurrences have a large effect on genomic diversity. Most notably, codon motifs apparently underpinned the preferences among codon positions for co-evolution which is probably highly biased during the origin of the genetic code. Our analysis also showed that variable nucleotide positions of different human sub-populations implemented the independent mtDNA evolution to its geographical dispensation. Ergo, this study has provided both a network framework and a codon glance to investigate co-occurring genomic variations that are critical in underlying complex mitochondrial evolution.