Signals and posttranslational modifications regulating the decapping step in mRNA degradation pathways are poorly defined. In this study we reveal the importance of K63-linked ubiquitylation for the assembly of decapping factors, P-body formation, and constitutive decay of instable mRNAs encoding mediators of inflammation by various experimental approaches. K63-branched ubiquitin chains also regulate IL-1-inducible phosphorylation of the P-body component DCP1a. The E3 ligase TRAF6 binds to DCP1a and indirectly regulates DCP1a phosphorylation, expression of decapping factors, and gene-specific mRNA decay. Mutation of six C-terminal lysines of DCP1a suppresses decapping activity and impairs the interaction with the mRNA decay factors DCP2, EDC4, and XRN1, but not EDC3, thus remodeling P-body architecture. The usage of ubiquitin chains for the proper assembly and function of the decay-competent mammalian decapping complex suggests an additional layer of control to allow a coordinated function of decapping activities and mRNA metabolism in higher eukaryotes.

Rice is a facultative short-day plant (SDP), and the regulatory pathways for flowering time are conserved, but functionally modified, in Arabidopsis and rice. Heading date 1 (Hd1), an ortholog of Arabidopsis CONSTANS (CO), is a key regulator that suppresses flowering under long-day conditions (LDs), but promotes flowering under short-day conditions (SDs) by influencing the expression of the florigen gene Heading date 3a (Hd3a). Another key regulator, Early heading date 1 (Ehd1), is an evolutionarily unique gene with no orthologs in Arabidopsis, which acts as a flowering activator under both SD and LD by promoting the rice florigen genes Hd3a and RICE FLOWERING LOCUST 1 (RFT1). Here, we report the isolation and characterization of the flowering regulator Heading Date Repressor1 (HDR1) in rice. The hdr1 mutant exhibits an early flowering phenotype under natural LD in a paddy field in Beijing, China (39°54'N, 116°23'E), as well as under LD but not SD in a growth chamber, indicating that HDR1 may functionally regulate flowering time via the photoperiod-dependent pathway. HDR1 encodes a nuclear protein that is most active in leaves and floral organs and exhibits a typical diurnal expression pattern. We determined that HDR1 is a novel suppressor of flowering that upregulates Hd1 and downregulates Ehd1, leading to the downregulation of Hd3a and RFT1 under LDs. We have further identified an HDR1-interacting kinase, OsK4, another suppressor of rice flowering under LDs. OsK4 acts similarly to HDR1, suppressing flowering by upregulating Hd1 and downregulating Ehd1 under LDs, and OsK4 can phosphorylate HD1 with HDR1 presents. These results collectively reveal the transcriptional regulators of Hd1 for the day-length-dependent control of flowering time in rice.

Mortalin/GRP75 is a ubiquitous mitochondrial chaperone which related to the cytosolic heat shock protein 70 (HSP70), and plays a role in carcinogenesis. This study aims to investigate the Mortalin expression in breast cancer and its correlation with the outcome of the patients with breast cancer.

Canker caused by the Ascomycete Valsa mali is the most destructive disease of apple in Eastern Asia, resulting in yield losses of up to 100%. This necrotrophic fungus induces severe necrosis on apple, eventually leading to the death of the whole tree. Identification of necrosis inducing factors may help to unravel the molecular bases for colonization of apple trees by V. mali. As a first step toward this goal, we identified and characterized the V. mali repertoire of candidate effector proteins (CEPs). In total, 193 secreted proteins with no known function were predicted from genomic data, of which 101 were V. mali-specific. Compared to non-CEPs predicted for the V. mali secretome, CEPs have shorter sequence length and a higher content of cysteine residues. Based on transient over-expression in Nicotiana benthamiana performed for 70 randomly selected CEPs, seven V. mali Effector Proteins (VmEPs) were shown to significantly suppress BAX-induced PCD. Furthermore, targeted deletion of VmEP1 resulted in a significant reduction of virulence. These results suggest that V. mali expresses secreted proteins that can suppress PCD usually associated with effector-triggered immunity (ETI). ETI in turn may play an important role in the V. mali-apple interaction. The ability of V. mali to suppress plant ETI sheds a new light onto the interaction of a necrotrophic fungus with its host plant.

Magnetic liposomes have been frequently used as nanocarriers for targeted drug delivery and magnetic resonance imaging in recent years. Despite great potentials, their morphological/structural instability in the physiological environment still remains an intractable challenge for clinical applications. In this study, stable hybrid liposomal cerasomes (ie, liposomes partially coated with silica) which can co-encapsulate Fe3O4 nanoparticles and the anticancer drug paclitaxel were developed using thin film hydration method. Compared with the drug loaded liposomes, the paclitaxel-loaded magnetic cerasomes (PLMCs) exhibited much higher storage stability and better sustained release behavior. Cellular uptake study showed that the utilization of an external magnetic field significantly facilitated the internalization of PLMCs into cancer cells, resulting in potentiated drug efficacy of killing tumor cells. The T2 relaxivity (r2) of our PLMCs was much higher than that of free Fe3O4 nanoparticles, suggesting increased sensitivity in T2-weighted imaging. Given its excellent biocompatibility also shown in the study, such dual functional PLMC is potentially a promising nanosystem for effective cancer diagnosis and therapy.

To evaluate the relationship between carotid stiffness and carotid intima-media thickness (CIMT) in patients with type 2 diabetes (T2DM).

Ezrin, which is known as a cytoskeleton linker protein, is closely linked with the metastatic progression of cancer and is frequently abnormally expressed in aggressive cancer types. However, the possible involvement of Ezrin in metastasis and angiogenesis in breast cancer remains unclear.

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6). Further evidence from a luciferase reporter assay, Q-RT-PCR and Western blotting indicates that S1 G-quadruplex formation can repress her2 promoter activity, and a selected G-quadruplex ligand cβ can enhance the repression by down regulating her2 transcription and expression. These findings provide a G-quadruplex target and perspective implications in her2 transcriptional regulation.

Background: Surgical resection is one of curative treatment for gastric cancer (GC), however, a set of patients show poor surgical compliance in the USA. We aimed to identify the risk factors associated with surgical compliance and investigate the difference in survival. Methods: GC patients diagnosed between 1973 and 2014 were identified from the Surveillance Epidemiology and End Results (SEER) databases. Based on different surgical compliance and treatment regimen, patients were classified into three subgroups: surgical compliance group, surgical noncompliance group, and non-surgical group. Multivariable Logistic regression analysis was adopted to identify the factors related to surgical compliance; Multivariable Cox regression was used to investigate the prognostic factors. Overall survival (OS) and cancer-specific survival (CSS) were analyzed using the Kaplan-Meier estimator method. Results: Of 79374 GC patients who were recommended for surgical therapy, 15201(19.2%) cases did not perform surgery. Poor compliance of surgery was related to old age, American Indian/Alaska Native race, poor grading/late staging, single/widowed status, lower socioeconomic status and earlier time of diagnosis. As expected, GC patients of surgical compliance group showed significantly more favorable survival than the other two groups (P<0.0001); notably, the outcome of surgical noncompliance group came close to that of non-surgical group. Conclusion: GC patients of poor surgical compliance demonstrated adverse survival, which was comparable to that of non-surgical patients. The poor surgical compliance was associated with older age, American Indian/Alaska Native race, poor tissue differentiation/advanced stage of tumor, single/widowed status, lower socioeconomic status and earlier time of diagnosis.

Genome-wide Association Study has presented a promising way to understand the association between human genomes and complex traits. Many simple polymorphic loci have been shown to explain a significant fraction of phenotypic variability. However, challenges remain in the non-triviality of explaining complex traits associated with multifactorial genetic loci, especially considering the confounding factors caused by population structure, family structure, and cryptic relatedness. In this paper, we propose a Squared-LMM (LMM2) model, aiming to jointly correct population and genetic confounding factors. We offer two strategies of utilizing LMM2 for association mapping: 1) It serves as an extension of univariate LMM, which could effectively correct population structure, but consider each SNP in isolation. 2) It is integrated with the multivariate regression model to discover association relationship between complex traits and multifactorial genetic loci. We refer to this second model as sparse Squared-LMM (sLMM2). Further, we extend LMM2/sLMM2 by raising the power of our squared model to the LMMn/sLMMn model. We demonstrate the practical use of our model with synthetic phenotypic variants generated from genetic loci of Arabidopsis Thaliana. The experiment shows that our method achieves a more accurate and significant prediction on the association relationship between traits and loci. We also evaluate our models on collected phenotypes and genotypes with the number of candidate genes that the models could discover. The results suggest the potential and promising usage of our method in genome-wide association studies.

Metallothioneins (MTs) are known to protect cells against oxidative stress, especially providing protection against cadmium (Cd) toxicity in hepatocytes. There are various gene variants and pseudogenes for MTs; however, there is little understanding on the functions of those non-coding MT members that are known to be expressed as long non-coding RNAs (lncRNAs) nowadays. Different from most protein-coding MT members, MT1DP was here found that remarkably induced to provoke cytotoxicity in hepatocytes in response to Cd treatment. MT1DP exerted such a pro-apoptotic function in Cd-treated hepatocytes through interacting with two partners: RhoC and MT1H. On one hand, MT1DP interacted with RhoC protein to increase the latter's stability by preventing lysosome-dependent protein degradation. Therefore, upon Cd stress, MT1DP/RhoC complex was quickly reinforced to activate RhoC-CCN1/2-AKT signaling and potentiate Ca2+ influx, leading to enhanced Cd uptake and elevated Cd toxicity. On the other hand, MT1H, a protein-coding member of the MT family with little known function, was found to quickly respond to Cd exposure along with MT1DP. Mechanistically, MT1H and MT1DP were uncovered to mutually protect each other through a reciprocal ceRNA mechanism, building up a positive feedback loop to enforce MT1DP-conducted signaling upon Cd exposure. Moreover, MT1DP was found to contribute much more to the activation of RhoC-CCN1/2-AKT signaling than MT1H. Considered together, we here unveiled a mystery whether a pseudogene within the MT family, MT1DP, has actual biological functions in regulating Cd-induced cellular defense. Our findings unearthed an important role of pseudogene MT1DP in calibrating the cellular machinery to switch the cellular defense to cytotoxicity through crosslinking an interplay between its two partners, namely MT1H and RhoC, under cadmium stress.

Endothelial cell apoptosis plays an important role in the pathophysiological mechanism of vascular complications in type 2 diabetes mellitus (T2DM). Argirein, a new synthetic compound was demonstrated to inactivate NADPH oxidase to alleviate cardiac dysfunction in T2DM. Here, we investigated whether argirein medication attenuated the vascular dysfunction in T2DM by inhibiting endothelial cell apoptosis which was associated with NADPH oxidase. The rat aortic endothelial cells (RAECs) were incubated with glucose (30 mM) for 48 hour in vitro. It was shown that high glucose significantly increased the protein expression of BAX (Bcl-2 Associated X protein) and Caspase-3 and decreased Bcl2 (B-Cell Leukemia/Lymphoma 2) protein level in RAECs, which was normalized by argirein medication. The annexin V-FITC bound cell percentage and DNA fragments in agarose electrophoresis were markedly suppressed by argirein to confirm the anti-apoptotic property of argirein in RAECs. Furthermore, we found that argirein blocked the endothelin (ET)-1/Nox4 signal-dependent superoxide (O2-.) generation, which regulated endothelial cell apoptosis in RAECs. In vivo, argirein intervention relieved the vasodilatory response to acetylcholine and restored the expressions of Nox4 and BAX in the aorta endothelium of high-fat diet (HFD)-fed rats following streptozocin (STZ) injection. For the first time, we demonstrated that argirein could inhibit vascular endothelial cell apoptosis, which was attributed to blocking ET-1/Nox4 signal-dependent O2- generation in RAECs. This current study revealed the therapeutic effects of argirein to prevent the vascular complication in T2DM through inhibiting endothelial cell apoptosis which was associated with the anti-oxidative property of argirein.

Drugs of abuse modulated learning and memory in humans yet the underlying mechanism remained unclear. The extracellular signal-regulated kinase (ERK) and the transcription factor cAMP response element-binding protein (CREB) were involved in neuroplastic changes associated with learning and memory. In the current study, we used a Morris water maze to examine the effect of methamphetamine (METH) on different processes of spatial memory in mice. We then investigated the status of ERK and CREB in the hippocampus and prefrontal cortex (PFC). We found that 1.0 mg/kg dose of METH facilitated spatial memory consolidation when it was injected immediately after the last learning trial. In contrast, the same dose of METH had no effect on spatial memory retrieval when it was injected 30 min before the test. Furthermore, 1.0 mg/kg dose of METH injected immediately after retrieval had no effect on spatial memory reconsolidation. Activation of both ERK and CREB in the hippocampus was found following memory consolidation but not after retrieval or reconsolidation in METH-treated mouse groups. In contrast, activation of both ERK and CREB in the PFC was found following memory retrieval but not other processes in METH-treated mouse groups. These results suggested that METH facilitated spatial memory consolidation but not retrieval or reconsolidation. Moreover, activation of the ERK and CREB signaling pathway in the hippocampus might be involved in METH-induced spatial memory changes.

Acid sphingomyelinase (ASM) has been implicated in the development of hyperhomocysteinemia (hHcys)-induced glomerular oxidative stress and injury. However, it remains unknown whether genetically engineering of ASM gene produces beneficial or detrimental action on hHcys-induced glomerular injury. The present study generated and characterized the mice lacking cystathionine β-synthase (Cbs) and Asm mouse gene by cross breeding Cbs(+/-) and Asm(+/-) mice. Given that the homozygotes of Cbs(-/-/)Asm(-/-) mice could not survive for 3 weeks. Cbs(+/-/)Asm(+/+), Cbs(+/-/)Asm(+/-) and Cbs(+/-/)Asm(-/-) as well as their Cbs wild type littermates were used to study the role of Asm(-/-) under a background of Cbs(+/-) with hHcys. HPLC analysis revealed that plasma Hcys level was significantly elevated in Cbs heterozygous (Cbs(+/-)) mice with different copies of Asm gene compared to Cbs(+/+) mice with different Asm gene copies. Cbs(+/-/)Asm(+/+) mice had significantly increased renal Asm activity, ceramide production and O(2.)(-) level compared to Cbs(+/+)/Asm(+/+), while Cbs(+/-/)Asm(-/-) mice showed significantly reduced renal Asm activity, ceramide production and O(2.)(-) level due to increased plasma Hcys levels. Confocal microscopy demonstrated that colocalization of podocin with ceramide was much lower in Cbs(+/-/)Asm(-/-) mice compared to Cbs(+/-/)Asm(+/+) mice, which was accompanied by a reduced glomerular damage index, albuminuria and proteinuria in Cbs(+/-/)Asm(-/-) mice. Immunofluorescent analyses of the podocin, nephrin and desmin expression also illustrated less podocyte damages in the glomeruli from Cbs(+/-/)Asm(-/-) mice compared to Cbs(+/-/)Asm(+/+) mice. In in vitro studies of podocytes, hHcys-enhanced O(2.)(-) production, desmin expression, and ceramide production as well as decreases in VEGF level and podocin expression in podocytes were substantially attenuated by prior treatment with amitriptyline, an Asm inhibitor. In conclusion, Asm gene knockout or corresponding enzyme inhibition protects the podocytes and glomeruli from hHcys-induced oxidative stress and injury.

Angiotensin II (AngII) induces cardiac hypertrophy and increases the expression of TR3. To determine whether TR3 is involved in the regulation of the pathological cardiac hypertrophy induced by AngII, we established mouse and rat hypertrophy models using chronic AngII administration. Our results reveal that a deficiency of TR3 in mice or the knockdown of TR3 in the left ventricle of rats attenuated AngII-induced cardiac hypertrophy compared with the respective controls. A mechanistic analysis demonstrates that the TR3-mediated activation of mTORC1 is associated with AngII-induced cardiac hypertrophy. TR3 was shown to form a trimer with the TSC1/TSC2 complex that specifically promoted TSC2 degradation via a proteasome/ubiquitination pathway. As a result, mTORC1, but not mTORC2, was activated; this was accompanied by increased protein synthesis, enhanced production of reactive oxygen species and enlarged cell size, thereby resulting in cardiac hypertrophy. This study demonstrates that TR3 positively regulates cardiac hypertrophy by influencing the effect of AngII on the mTOR pathway. The elimination or reduction of TR3 may reduce cardiac hypertrophy; therefore, TR3 is a potential target for clinical therapy.

Pancreatic cancer remains fatal to the fast majority of affected patients. Activation of phosphoinositide-3 kinase (PI3K)-AKT-mammalian target of rapamycin (mTOR) pathway plays an important role in pancreatic cancer progression and chemo-resistance. In the present study, we examined the activity of GDC-0980, a novel class I PI3K/mTOR kinase inhibitor, against pancreatic cancer cells in vitro. GDC-0980 inhibited AKT-mTOR activation and pancreatic cancer cell (PANC-1 and Capan-1 lines) survival. In both cancer cell lines, GDC-0980 simultaneously activated apoptosis and autophagy, the latter was detected by p62 degradation, Beclin-1 upregulation and light chain 3B (LC3B) conversion from a cytosolic (LC3B-I) to a membrane-bound (LC3B-II) form. Autophagy inhibitors including 3-methyladenine, hydroxychloroquine, NH4Cl and bafilomycin A1 enhanced apoptosis and cytotoxicity by GDC-0980, such an effect was reversed by caspase inhibitors (z-VAD-FMK and z-ITED-FMK). Furthermore, knockdown of LC3B or Beclin-1 through siRNA increased GDC-0980-induced anti-pancreatic cancer cell activity. Thus, inhibition of autophagy sensitizes GDC-0980-induced anti-pancreatic cancer activity, suggesting a novel therapeutic strategy for GDC-0980 sensitization.

Telocytes (TCs), a distinct type of interstitial cells, have been identified in many organs via electron microscopy. However, their precise function in organ regeneration remains unknown. This study investigated the paracrine effect of renal TCs on renal tubular epithelial cells (TECs) in vitro, the regenerative function of renal TCs in renal tubules after ischaemia-reperfusion injury (IRI) in vivo and the possible mechanisms involved. In a renal IRI model, transplantation of renal TCs was found to decrease serum creatinine and blood urea nitrogen (BUN) levels, while renal fibroblasts exerted no such effect. The results of histological injury assessments and the expression levels of cleaved caspase-3 were consistent with a change in kidney function. Our data suggest that the protective effect of TCs against IRI occurs via inflammation-independent mechanisms in vivo. Furthermore, we found that renal TCs could not directly promote the proliferation and anti-apoptosis properties of TECs in vitro. TCs did not display any advantage in paracrine growth factor secretion in vitro compared with renal fibroblasts. These data indicate that renal TCs protect against renal IRI via an inflammation-independent pathway and that growth factors play a significant role in this mechanism. Renal TCs may protect TECs in certain microenvironments while interacting with other cells.

NQO1 is a FAD-binding protein that can form homodimers and reduce quinones to hydroquinones, and a growing body of evidence currently suggests that NQO1 is dramatically elevated in solid cancers. Here, we demonstrated that NQO1 was elevated in breast cancer and that its expression level was positively correlated with invasion and reduced disease free survival (DFS) and overall survival (OS) rates. Next, we found that β-lapachone exerted significant anti-proliferation and anti-metastasis effects in breast cancer cell lines due to its effects on NQO1 expression. Moreover, we revealed that the anti-cancer effects of β-lapachone were mediated by the inactivation of the Akt/mTOR pathway. In conclusion, these results demonstrated that NQO1 could be a useful prognostic biomarker for patients with breast cancer, and its bioactivatable drug, β-lapachone represented a promising new development and an effective strategy for indicating the progression of NQO1-positive breast cancers.

Aging is associated with increased cellular senescence, which is hypothesized to drive the eventual development of multiple comorbidities. Here we investigate a role for senescent cells in age-related bone loss through multiple approaches. In particular, we used either genetic (i.e., the INK-ATTAC 'suicide' transgene encoding an inducible caspase 8 expressed specifically in senescent cells) or pharmacological (i.e., 'senolytic' compounds) means to eliminate senescent cells. We also inhibited the production of the proinflammatory secretome of senescent cells using a JAK inhibitor (JAKi). In aged (20- to 22-month-old) mice with established bone loss, activation of the INK-ATTAC caspase 8 in senescent cells or treatment with senolytics or the JAKi for 2-4 months resulted in higher bone mass and strength and better bone microarchitecture than in vehicle-treated mice. The beneficial effects of targeting senescent cells were due to lower bone resorption with either maintained (trabecular) or higher (cortical) bone formation as compared to vehicle-treated mice. In vitro studies demonstrated that senescent-cell conditioned medium impaired osteoblast mineralization and enhanced osteoclast-progenitor survival, leading to increased osteoclastogenesis. Collectively, these data establish a causal role for senescent cells in bone loss with aging, and demonstrate that targeting these cells has both anti-resorptive and anabolic effects on bone. Given that eliminating senescent cells and/or inhibiting their proinflammatory secretome also improves cardiovascular function, enhances insulin sensitivity, and reduces frailty, targeting this fundamental mechanism to prevent age-related bone loss suggests a novel treatment strategy not only for osteoporosis, but also for multiple age-related comorbidities.

We previously showed that DNA fragmentation factor, which comprises a caspase-3-activated DNase (CAD) and its inhibitor (ICAD), may influence the rate of cell death by generating PARP-1-activating DNA breaks. Here we tested the hypothesis that ICAD-deficient colon epithelial cells exhibiting resistance to death stimuli may accumulate additional genetic modifications, leading to a tumorigenic phenotype. We show that ICAD deficiency may be associated with colon malignancy in humans. Indeed, an examination of ICAD expression using immunohistochemistry in an array of both colon cancer and normal tissues revealed that ICAD expression levels were severely compromised in the cancerous tissues. Upon DNA damage caused by a low dose of irradiation, ICAD cells acquire a tumorigenic phenotype. Colon epithelial cells derived from ICAD mice showed a significant resistance to death induced by the colon carcinogen dimethylhydrazine in vitro and in mice. Such resistance was associated with a decrease in PARP-1 activation. In an animal model of dimethylhydrazine-induced colon tumorigenesis, ICAD(-/-) mice developed significantly higher numbers of tumors with markedly larger sizes than the wild-type counterparts. Interestingly, the phenotype of the ICAD(-/-) mice was not associated with a significant increase in the precancerous aberrant crypt foci suggesting a potential link to tumor progression rather than initiation. More importantly, ICAD deficiency was associated with severe genomic instability as assessed by array comparative genomic hybridization. Such genomic instability consisted most prominently of amplifications but with sizable deletions as compared to the wild-type counterparts affecting several cancer-related genes including RAF-1, GSN, LMO3, and Fzd6 independently of p53. Altogether, our results present a viable case for the involvement of ICAD deficiency in colon carcinogenesis and show that apoptosis and genomic instability may comprise the means by which such deficiency may contribute to the process of increasing susceptibility to carcinogen-induced tumorigenesis.