You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.wormbase.org/db/get?name=WBStrain00037906.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).

View Resource Report


Organism Name
VC4077
RRID:WB-STRAIN:WBStrain00037906 RRID Copied  
PDF Report How to cite 
RRID:WB-STRAIN:WBStrain00037906
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00037906

Proper Citation: RRID:WB-STRAIN:WBStrain00037906

Description: Caenorhabditis elegans with name lbp-8(gk5151[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. from WB.

Species: Caenorhabditis elegans

Synonyms: lbp-8(gk5151[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.

Notes: Homozygous viable. Deletion of 438 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ATTAACAACTCAATTAATTCAGTCCTTCCT ; Right flanking sequence: CTGGGAGCGTCATTTGTCGTAGAGAGTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Affected Gene: WBGene00002260(lbp-8)|WBGene00003515(myo-3)|WBGene00004496(rps-27)|WBGene00006789(unc-54)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts
Report Information

No rating or validation information has been found for VC4077.

No alerts have been found for VC4077.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)