URL: http://www.addgene.org/18738
Proper Citation: RRID:Addgene_18738
Insert Name: DscamL
Organism: Mus musculus
Bacterial Resistance: Kanamycin
Defining Citation: PMID:18216854
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMV script; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: A fragment of mouse Dscam-like-1 cDNA was amplified from the mKIAA1132 plasmid (Kazusa DNA Research Institute) using the following primers: GGCCGCGGCCGCCCGCACGGCCGGCCACAGGACCACC and CGCGGTCGACAGGTCCCAGTGTGGAGCCCTTCTCC. This fragment was cloned into the NotI/SalI sites of pCMVscript. To complete its open reading frame, a BglII fragment of this plasmid was replaced by a cDNA amplified from mouse brain using the following primers: GGCCAGATCTCCGCACGGCCGGCCACAGGACCACC and CGCGAGATCTGTTGCCGTTGTGCTTGAGGGAGAC.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCMV mouse Dscam-like.
No alerts have been found for pCMV mouse Dscam-like.
Source: Addgene