Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search

Type in a keyword to search

on page 1 showing 20 out of 42 results

Cite this (WB Cat# ZB1335, RRID:WB-STRAIN:ZB1335)

Source Database: WB, catalog # ZB1335
Genetic Background:
Affected Genes: WBGene00001612(glr-1), WBGene00001613(glr-2), WBGene00001621(glt-3)
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (RGD Cat# 13792794, RRID:RGD_13792794)

Source Database: RGD, catalog # 13792794
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: A pair of TALENs targeting exon 1 of the Fh gene was injected into SD embryos to create Fh knock out mutants. The resulting mutation was an 11-bp deletion (acacctttggt) on exon 1 that caused premature stop of FH protein. No homozygous -/- mutant was revealed in litters.

  • From Current Category

Cite this (RGD Cat# 13793378, RRID:RGD_13793378)

Source Database: RGD, catalog # 13793378
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in exon 2. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 13793372, RRID:RGD_13793372)

Source Database: RGD, catalog # 13793372
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tlr4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 2. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 13792808, RRID:RGD_13792808)

Source Database: RGD, catalog # 13792808
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.

  • From Current Category

Cite this (WB Cat# CG1250, RRID:WB-STRAIN:CG1250)

Source Database: WB, catalog # CG1250
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar02148926(cg396)
Availability: live
Reference:
Notes: mutagen: EMS

  • From Current Category

Cite this (RGD Cat# 13792727, RRID:RGD_13792727)

Source Database: RGD, catalog # 13792727
Genetic Background: outbred
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: Zentralinstitut fur Versuchstierzucht (Hannover)1982 (from Allington Farm - UK 1964. ). This strain was selected by DONALDSON in 1906 at the Wistar Institute (USA), from a batch belonging to Chicago University (RUSSEL-LINDSAY, 1979). Janvier Labs

  • From Current Category

Cite this (WB Cat# ZB1105, RRID:WB-STRAIN:ZB1105)

Source Database: WB, catalog # ZB1105
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (WB Cat# ZB1096, RRID:WB-STRAIN:ZB1096)

Source Database: WB, catalog # ZB1096
Genetic Background:
Affected Genes: WBGene00001621(glt-3)
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (WB Cat# ZB1103, RRID:WB-STRAIN:ZB1103)

Source Database: WB, catalog # ZB1103
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (WB Cat# ZB1336, RRID:WB-STRAIN:ZB1336)

Source Database: WB, catalog # ZB1336
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (WB Cat# ZB1104, RRID:WB-STRAIN:ZB1104)

Source Database: WB, catalog # ZB1104
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (RGD Cat# 13792575, RRID:RGD_13792575)

Source Database: RGD, catalog # 13792575
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This ZFN wild type rats are littermates of cross of heterozygotes. The Lepr mutant model possesses a 151 bp deletion spanning exon 1/intron 1 junction of Leptin gene. Homozygous knockout rats display loss of Leptin protein via Western blot. Homozygous knockout rats demonstrate significant weight gain compared to wild type littermates. Homozygous knockout rats show significantly elevated serum cholesterol levels

  • From Current Category

Cite this (RGD Cat# 13792683, RRID:RGD_13792683)

Source Database: RGD, catalog # 13792683
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. This wild type mutant is the wild type offspring from the cross of heterozygous mutants. Thomas Jefferson University, Philadelphia

  • From Current Category

Cite this (RGD Cat# 13792570, RRID:RGD_13792570)

Source Database: RGD, catalog # 13792570
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: The original mutants were created by target-selected ENU-induced mutagenesis in a Brown Norway background. The animals were outcrossed for two generations on a Brown Norway background. they were subsequently backcrossed on a Wistar (Crl:WI) background for four generations. Backcrossings were performed to eliminate possible additional mutations induced by ENU-mutagenesis. Heterozygous oprl1+/- rats were crossed to generate the experimental animals. A C to G transversion at position 3657 in the oprl1 gene (ENSRNOG00000016768), resulting into a premature stop codon (TAC>TAG) in the third exon. Hubrecht Laboratory, Utrecht, The Netherlands

  • From Current Category

Cite this (RGD Cat# 13792705, RRID:RGD_13792705)

Source Database: RGD, catalog # 13792705
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These ZFN mutant rats were produced by injecting zinc finger nuclease targeting exon 13 of rat Trpv1 into Sprague Dawley embryos. A 2-bp (CA) frameshift deletion in exon 13 was created ( SD-Trpv1em1Sage-/-). This wild type mutant is the wild type offspring from the cross of heterozygous mutants.

  • From Current Category

Cite this (RGD Cat# 13792803, RRID:RGD_13792803)

Source Database: RGD, catalog # 13792803
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This allele was made by CRISPR/Cas9 system. The resulting mutation is a 10-bp insertion in Exon 2 of the P2rx7 gene.

  • From Current Category

Cite this (WB Cat# ZB1337, RRID:WB-STRAIN:ZB1337)

Source Database: WB, catalog # ZB1337
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes:

  • From Current Category

Cite this (RGD Cat# 13793376, RRID:RGD_13793376)

Source Database: RGD, catalog # 13793376
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Avpr2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 30-bp deletion in exon 2. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 13782280, RRID:RGD_13782280)

Source Database: RGD, catalog # 13782280
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: Zinc Finger Nuclease (ZFN) was utilized to knockout rat Kcnj1 function. ZFN constructs targeting the gene were designed and purchased from Sigma Aldrich (St. Louis, MO, USA).The targeting site sequence is CTCAAGTGACCATAGGTTACGgattcaGGTTTGTGAC (lower case represents the ZFN cleavage site). Kcnj1 knockout founders were generated by microinjection of ZFN mRNAs into single -cell SS (from Harlan) rat embryos. The resulting mutation is 209 bp deletion from G225 to G433, leading to frameshift and premature termination of Kcnj1 protein. This strain is the wild type littermate from heterozygous cross. Departments of Cardiovascular Diseases, Merck Research Laboratories, Merck&Co.,Inc

  • From Current Category

  1. Resource Identification Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X