Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.


Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.


Type in a keyword to search

on page 1 showing 20 out of 3,782 results

Cite this (RGD Cat# 1554310, RRID:RGD_1554310)

Source Database: RGD, catalog # 1554310
Genetic Background: transgenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: lacZ cDNA was inserted in the EcoRI site of the pCAGGS expression vector. This DNA was microinjected into the DA/Crlj. The expression of the transgene was determined by beta-gal staining. National BioResource Project for the Rat in Japan, Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 70416, RRID:RGD_70416)

Source Database: RGD, catalog # 70416
Genetic Background: inbred strain
Affected Genes:
Genomic Alteration:
Availability: live
Notes: increased lymphoma incidence Curtiss and Dunning 1926 at Columbia University Institute for Cancer Research.

  • From Current Category

Cite this (RGD Cat# 5144102, RRID:RGD_5144102)

Source Database: RGD, catalog # 5144102
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Notes: This strain was produced by injecting ZFNs targeting the sequence agccacctggtatttgaggagacgcttggagatgac into ACI.FHH(D1Mit18-D1Rat90)(D14Mit11-D14Rat33)(D14Rat65-D14Rat90) embryos. The result is a 5-bp frameshift deletion in exon 2. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 724571, RRID:RGD_724571)

Source Database: RGD, catalog # 724571
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: live
Notes: This strain was established from captured Japanese wild rats. Laboratory of Animal Reproduction, Nagoya University, Nagoya, Japan

  • From Current Category

Cite this (RGD Cat# 1581628, RRID:RGD_1581628)

Source Database: RGD, catalog # 1581628
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: This congenic strain contains an ACI chromosome 15 segment transferred to the DA background strain Center for Molecular Medicine, Department of Clinical Neuroscience, Neuroimmunology Unit, Karolinska Institutet, SE-17176 Stockholm, Sweden

  • From Current Category

Cite this (RGD Cat# 5508398, RRID:RGD_5508398)

Source Database: RGD, catalog # 5508398
Genetic Background: outbred
Affected Genes:
Genomic Alteration:
Availability: live
Notes: From the University of Rochester, Rochester, New York; to Blue Spruce Farms, Altamont, New York, in 1964; to Harlan through acquisition in 1988. Harlan became Envigo in 2015. Harlan/Envigo

  • From Current Category

Cite this (RGD Cat# 7204133, RRID:RGD_7204133)

Source Database: RGD, catalog # 7204133
Genetic Background: mutant strain
Affected Genes:
Genomic Alteration:
Availability: live
Reference: PMID:23136839
Notes: severe combined immunodeficiency, decreased B cell number, decreased T cell number, small thymus This strain was produced by injecting ZFNs into LEW/Ztm rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. Zentrales Tierlaboratorium, Medizinische Hochschule Hannover, Germany

  • From Current Category

Cite this (RGD Cat# 6484580, RRID:RGD_6484580)

Source Database: RGD, catalog # 6484580
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Notes: This strain was produced by injecting ZFNs targeting the sequence TGCATCCCCAGCCTGTGGgcctgcGACGGGGACCGGGAC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 123-bp frameshift deletion in exon 4. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 13207560, RRID:RGD_13207560)

Source Database: RGD, catalog # 13207560
Genetic Background: transgenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: Transgenic overexpressing tamoxifen inducible cre/ERT2 under the control of the Aquaporin 2 promoter MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 5131933, RRID:RGD_5131933)

Source Database: RGD, catalog # 5131933
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Notes: This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 731195, RRID:RGD_731195)

Source Database: RGD, catalog # 731195
Genetic Background: congenic strain
Affected Genes:
Genomic Alteration:
Availability: live
Reference: PMID:14624754
Notes: arthritis The fragment of interest is transferred from arthritis resistant E3 strain to the susceptible DA strain. Medical Inflammation Research, BMC, University of Lund, Lund, Sweden

  • From Current Category

Cite this (RGD Cat# 7771600, RRID:RGD_7771600)

Source Database: RGD, catalog # 7771600
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: Congenic strain which was generated using the speed congenic strategy by backcrossing SS/JrHsd and SR/JrHsd parental strains Boston University School of Medicine, Boston, Massachusetts. Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 728195, RRID:RGD_728195)

Source Database: RGD, catalog # 728195
Genetic Background: congenic strain
Affected Genes:
Genomic Alteration:
Availability: live
Notes: increased systemic arterial blood pressure Autosomal recessive congenic strain originated from an inbred transfered to NIH in 1966 at F13 from Okamoto. Okamoto, Kyoto School of Medicine, 1963, from outbred Wistar Kyoto male with marked elevation of blood pressure mated to female with slightly elevated blood pressure; brother-sister mating with contin- ued selection for spontaneous hypertension. Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 5688409, RRID:RGD_5688409)

Source Database: RGD, catalog # 5688409
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: This congenic strain contains a region of COP/CrCrl chromosome 5 transferred to the ACI/SegHsd strain background. Department of Oncology, McArdle Laboratory for Cancer Research, University of Wisconsin-Madison

  • From Current Category

Cite this (RGD Cat# 2305949, RRID:RGD_2305949)

Source Database: RGD, catalog # 2305949
Genetic Background: consomic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: Chromosome 1 from WKY is introgressed into the genomic background of SHRSP National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 8549785, RRID:RGD_8549785)

Source Database: RGD, catalog # 8549785
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: Developed by the DEPOSITOR National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 9588593, RRID:RGD_9588593)

Source Database: RGD, catalog # 9588593
Genetic Background: transgenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: The transgene expresses BAC transgenic using rat GAD1 promoter to express Cre recombinase in GABAergic neurons Optogenetics and Transgenic Technology Core, Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 2301702, RRID:RGD_2301702)

Source Database: RGD, catalog # 2301702
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 4th intron of the Sf4 gene. PhysGen, Transposagen, Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 734526, RRID:RGD_734526)

Source Database: RGD, catalog # 734526
Genetic Background: inbred strain
Affected Genes:
Genomic Alteration:
Availability: live
Reference: PMID:11355573
Notes: hyperglycemia, increased circulating insulin level, insulin resistance Long Evans Charles River Canada introduced it to Otsuka Pharmaceutical Co. in 1982. This is selectively bred by oral glucose tolerance test of selective brother-sister mating. Otsuka Pharmacuetical Company, 463-10 Kagasuno, Tokushima, Japan

  • From Current Category

Cite this (RGD Cat# 737868, RRID:RGD_737868)

Source Database: RGD, catalog # 737868
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: live
Notes: Congenic substrain which has a chromosome 13 segment from congenic SS/Jr.SR/Jr-Ren transferred to the SS/Jr recipient strain Medical College of Ohio, Toledo, Ohio, USA

  • From Current Category

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.