Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.


Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.


Type in a keyword to search

on page 1 showing 20 out of 40,508 results

Cite this (WB Cat# IE9574, RRID:WB-STRAIN:IE9574)

Source Database: WB, catalog # IE9574
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00256083(ttTi9574)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE42446, RRID:WB-STRAIN:IE42446)

Source Database: WB, catalog # IE42446
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00264440(ttTi42446)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE43554, RRID:WB-STRAIN:IE43554)

Source Database: WB, catalog # IE43554
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00264792(ttTi43554)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE19283, RRID:WB-STRAIN:IE19283)

Source Database: WB, catalog # IE19283
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00258405(ttTi19283)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE10810, RRID:WB-STRAIN:IE10810)

Source Database: WB, catalog # IE10810
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00256405(ttTi10810)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# VC3992, RRID:WB-STRAIN:VC3992)

Source Database: WB, catalog # VC3992
Genetic Background:
Affected Genes: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012646(lron-10)
Genomic Alteration:
Availability: live
Notes: mutagen: Crispr/Cas9; outcrossed: x0; other notes: Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details."|"Made_by: Vancouver KO Group

  • From Current Category

Cite this (WB Cat# LS2342, RRID:WB-STRAIN:LS2342)

Source Database: WB, catalog # LS2342
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00066489(cxTi4314)
Availability: live
Reference: WBPaper00024297
Notes: other notes: For further information and strain requests please visit

  • From Current Category

Cite this (WB Cat# IE35100, RRID:WB-STRAIN:IE35100)

Source Database: WB, catalog # IE35100
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00261970(ttTi35100)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# JN1715, RRID:WB-STRAIN:JN1715)

Source Database: WB, catalog # JN1715
Genetic Background:
Affected Genes: NULL
Genomic Alteration: NULL
Availability: No longer indexed by source database

  • From Current Category

Cite this (WB Cat# JN1715, RRID:WB-STRAIN:JN1715)

Source Database: WB, catalog # JN1715
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: live
Notes: mutagen: UV for integration of Ex into the genome; outcrossed: x4; other notes: peIs1715 [str-1p::mCasp-1 + unc-122p::mCherry]. AWB neurons are eliminated. Abnormal odor chemotaxis. Reference: Yoshida K, et al. Nat Commun. 2012 Mar 13;3:739.

  • From Current Category

Cite this (WB Cat# IE37709, RRID:WB-STRAIN:IE37709)

Source Database: WB, catalog # IE37709
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00263036(ttTi37709)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE43717, RRID:WB-STRAIN:IE43717)

Source Database: WB, catalog # IE43717
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00264840(ttTi43717)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE39532, RRID:WB-STRAIN:IE39532)

Source Database: WB, catalog # IE39532
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00263585(ttTi39532)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE21285, RRID:WB-STRAIN:IE21285)

Source Database: WB, catalog # IE21285
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00258921(ttTI21285)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE2725, RRID:WB-STRAIN:IE2725)

Source Database: WB, catalog # IE2725
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00253842(ttTi2725)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE32433, RRID:WB-STRAIN:IE32433)

Source Database: WB, catalog # IE32433
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00261120(ttTi32433)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE21159, RRID:WB-STRAIN:IE21159)

Source Database: WB, catalog # IE21159
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00258886(ttTI21159)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# IE19459, RRID:WB-STRAIN:IE19459)

Source Database: WB, catalog # IE19459
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00258453(ttTi19459)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (WB Cat# FAS32, RRID:WB-STRAIN:FAS32)

Source Database: WB, catalog # FAS32
Genetic Background:
Affected Genes: WBGene00012276(his-74)
Genomic Alteration:
Availability: live
Notes: mutagen: Crispr/Cas9; outcrossed: x0; other notes: Made_by: Kamila Delaney"|"Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

  • From Current Category

Cite this (WB Cat# IE35360, RRID:WB-STRAIN:IE35360)

Source Database: WB, catalog # IE35360
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00262075(ttTi35360)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

  1. Resource Identification Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.