Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
on page 1 showing 20 out of 789 results from 1 sources

Cite this (RGD Cat# 4139885, RRID:RGD_4139885)

Source Database: RGD, catalog # 4139885
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 12790676, RRID:RGD_12790676)

Source Database: RGD, catalog # 12790676
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the P2rx1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 2-bp deletion in Exon 2 of the P2rx1 gene. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 5688111, RRID:RGD_5688111)

Source Database: RGD, catalog # 5688111
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5508357, RRID:RGD_5508357)

Source Database: RGD, catalog # 5508357
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs targeting the sequence GTCTGAGTTTACcaatgcGAGTAACCATCTGGCAGCT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 6. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5688094, RRID:RGD_5688094)

Source Database: RGD, catalog # 5688094
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5508369, RRID:RGD_5508369)

Source Database: RGD, catalog # 5508369
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGATGGGCAGCACCATGgaccccCCGGGGGGTGCA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 2290067, RRID:RGD_2290067)

Source Database: RGD, catalog # 2290067
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: this Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). PGA

  • From Current Category

Cite this (RGD Cat# 2301081, RRID:RGD_2301081)

Source Database: RGD, catalog # 2301081
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Mmel1. PhysGen, Rat Resource and Research Center, Transposagen

  • From Current Category

Cite this (RGD Cat# 2306279, RRID:RGD_2306279)

Source Database: RGD, catalog # 2306279
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Diaph3 gene. PhysGen, Transposagen, Rat Resource & Research Center

  • From Current Category

Cite this (RGD Cat# 2314377, RRID:RGD_2314377)

Source Database: RGD, catalog # 2314377
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: A male rat "SRR-Rocket Science" was introduced from American fancy rat colony (Spoiled Ratten Rattery: SRR, in Kansas City, Missouri) to Kyoto University on July 13, 2005. Inbreeding started from F1 progeny of male "SRR-Rocket Science" and a female PVG/Seac. Homozygous rats for grey mutation were selected for inbreeding. National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 10054453, RRID:RGD_10054453)

Source Database: RGD, catalog # 10054453
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sirt3 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in the Sirt3 gene. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 13204788, RRID:RGD_13204788)

Source Database: RGD, catalog # 13204788
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a 60-bp deletion in exon 2 of the rat Pappa2 gene of SS.BN-(D13Hmgc1048-D13Hmgc1050)/Mcwi rat embryos. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 12879424, RRID:RGD_12879424)

Source Database: RGD, catalog # 12879424
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was established at Kyoto University. ChR90/EGFP fusion gene sequence under CAG promoter is knock-in at the Rosa26 locus. Background strain: Long-Evans strain (charles river). COP4*: Stigeoclonium helveticum-derived channelrhodopsin (Chronos, ChR90) National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 12790615, RRID:RGD_12790615)

Source Database: RGD, catalog # 12790615
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Chrna4 gene of LEW/Crl rat embryos. The resulting mutation is a 4-bp deletion in the Chrna4 gene. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 5686684, RRID:RGD_5686684)

Source Database: RGD, catalog # 5686684
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5686721, RRID:RGD_5686721)

Source Database: RGD, catalog # 5686721
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 7241052, RRID:RGD_7241052)

Source Database: RGD, catalog # 7241052
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 5-bp frameshift deletion in exon 4 (TCAGT). Horizon Discovery

  • From Current Category

Cite this (RGD Cat# 2302658, RRID:RGD_2302658)

Source Database: RGD, catalog # 2302658
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Bbx gene. PhysGen, Transposagen, Rat Resource & Research Center

  • From Current Category

Cite this (RGD Cat# 5509994, RRID:RGD_5509994)

Source Database: RGD, catalog # 5509994
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5686732, RRID:RGD_5686732)

Source Database: RGD, catalog # 5686732
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

  1. Resource Identification Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X