Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
on page 1 showing 20 out of 796 results from 1 sources

Cite this (RGD Cat# 2313465, RRID:RGD_2313465)

Source Database: RGD, catalog # 2313465
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. PhysGen,Transposagen, Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 2314244, RRID:RGD_2314244)

Source Database: RGD, catalog # 2314244
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: In the course of producing transgenic rats (DRPLA promoter + huntingtin exon1+EGFP on a Slc:SD background), a mutant rat showing involuntary movements (circling) and symptoms of dystonia was found in F6 progeny. Subsequent by the selection of the involuntary movement segregated the transgene from the phenotype. Thereafter this strain was maintained by only the phenotype (not the transgene). National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 12738466, RRID:RGD_12738466)

Source Database: RGD, catalog # 12738466
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: Developed by Beth Bauer, University of Missouri. Spontaneous mutation of agouti gene with resultant black coat color from Sprague Dawley (SD) X Dark Agouti (DA). Albino mutation and hooded mutation have been bred out of this line so that only the agouti mutation remains. Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 2290105, RRID:RGD_2290105)

Source Database: RGD, catalog # 2290105
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 17th intron of the Sptbn4 gene. PGA

  • From Current Category

Cite this (RGD Cat# 11040948, RRID:RGD_11040948)

Source Database: RGD, catalog # 11040948
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was established by Zinc-finger nucleases (ZFNs) method taregting rat Prkdc gene (227-bp deletion) and Il2rg gene (332-bp deletion). Background strain: F344/Stm National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 2302662, RRID:RGD_2302662)

Source Database: RGD, catalog # 2302662
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 6th intron of the Slc7a11 gene. PhysGen, Transposagen, Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 5143988, RRID:RGD_5143988)

Source Database: RGD, catalog # 5143988
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5686684, RRID:RGD_5686684)

Source Database: RGD, catalog # 5686684
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 2290083, RRID:RGD_2290083)

Source Database: RGD, catalog # 2290083
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Slc24a3 gene. PGA

  • From Current Category

Cite this (RGD Cat# 10450489, RRID:RGD_10450489)

Source Database: RGD, catalog # 10450489
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences

  • From Current Category

Cite this (RGD Cat# 6483454, RRID:RGD_6483454)

Source Database: RGD, catalog # 6483454
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This allele was made by ZFN mutagenesis. The resulting mutation is a 32-bp frameshift deletion in exon 1 (del 74-105) Medical College of Wisconsin, Milwaukee WI

  • From Current Category

Cite this (RGD Cat# 10413850, RRID:RGD_10413850)

Source Database: RGD, catalog # 10413850
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs into SD embryos, the resulting mutation is a 10-bp deletion. Thomas Jefferson University, Philadelphia

  • From Current Category

Cite this (RGD Cat# 12790954, RRID:RGD_12790954)

Source Database: RGD, catalog # 12790954
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Tert gene of WKY/NCrl rat embryos. The resulting mutation is a 17-bp deletion in Tert gene. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 10054398, RRID:RGD_10054398)

Source Database: RGD, catalog # 10054398
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Gla gene of DA/OlaHsd rat embryos. The resulting mutation is a 47-bp deletion in the Gla gene. MCW Gene Editing Rat Resource Center

  • From Current Category

Cite this (RGD Cat# 1579698, RRID:RGD_1579698)

Source Database: RGD, catalog # 1579698
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: Male founders are injected with ENU (N-ethyl-N-nitrosourea) and harem bred to females. The pups are genetically screened using the TILLING assay (an enzyme-based heteroduplex cleavage assay) as well as nucleotide sequencing to identify and characterize target genes possessing ENU-induced mutations. G393V mutation is generated on rat Adra1a. PhysGen, Rat Resource and Research Center

  • From Current Category

Cite this (RGD Cat# 11564346, RRID:RGD_11564346)

Source Database: RGD, catalog # 11564346
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: The TALEN genome editing system was used to generate this mutant rat strain. The TALEN system caused a 14-bp deletion in the exon4 of Aspa gene, as a result created a premature stop codon in the gene. Decreased expression levels of Aspa gene and ASPA protein was observed. Histopatologically, this strain shows vacuole formation in the brain and spinal cord. National BioResource Project for the Rat in Japan

  • From Current Category

Cite this (RGD Cat# 5688037, RRID:RGD_5688037)

Source Database: RGD, catalog # 5688037
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 5688020, RRID:RGD_5688020)

Source Database: RGD, catalog # 5688020
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 4139876, RRID:RGD_4139876)

Source Database: RGD, catalog # 4139876
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. PhysGen Knockouts

  • From Current Category

Cite this (RGD Cat# 10054411, RRID:RGD_10054411)

Source Database: RGD, catalog # 10054411
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 3-bp deletion in the Kcnj10 gene. MCW Gene Editing Rat Resource Center

  • From Current Category

  1. Resource Identification Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X