Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search

Type in a keyword to search

on page 2 showing 20 out of 623,700 results

Cite this (ZFIN Cat# ZDB-GENO-120730-21, RRID:ZFIN_ZDB-GENO-120730-21)

Source Database: ZFIN, catalog # ZDB-GENO-120730-21
Genetic Background: TL
Affected Genes:
Genomic Alteration: zf328Et
Availability:
Reference:
Notes: ZFIN prefers authors to cite using the other (ZDB-ALT-prefixed) identifier.

  • From Current Category

Cite this (MGI Cat# 4431220, RRID:MGI:4431220)

Source Database: MGI, catalog # 4431220
Genetic Background: involves: C57BL/6J
Affected Genes: Phex
Genomic Alteration: Hyp; Tg(Bglap2-Phex)1Ldq
Availability: Availability unknown check source stock center
Reference: PMID:11713245
Notes: osteomalacia, abnormal bone mineralization, rickets, decreased bone mass, decreased circulating phosphate level Allele Detail: Spontaneous, Transgenic

  • From Current Category

Cite this (ZIRC Cat# ZL251, RRID:ZIRC_ZL251)

Source Database: ZIRC, catalog # ZL251
Genetic Background: AB
Affected Genes: flw
Genomic Alteration: m735
Availability: frozen
Reference:
Notes: - Unknown

  • From Current Category

Cite this (FlyBase Cat# FBst1005021, RRID:FlyBase_FBst1005021)

Source Database: FlyBase, catalog # FBst1005021
Genetic Background:
Affected Genes:
Genomic Alteration: PBac{PB}NetB[c00047]
Availability: Availability unknown check source stock centers
Reference:
Notes:

  • From Current Category

Cite this (MGI Cat# 2661449, RRID:MGI:2661449)

Source Database: MGI, catalog # 2661449
Genetic Background: involves: 129P2/OlaHsd * C57BL
Affected Genes: Pzp
Genomic Alteration: tm1Vln
Availability: Availability unknown check source stock center
Reference: PMID:7544347
Notes: greasy coat, abnormal bile color, hypoactivity, homeostasis/metabolism phenotype, hepatic steatosis, decreased sensitivity to induced morbidity/mortality, enlarged liver, disheveled coat, decreased susceptibility to weight gain, pancreas inflammation, neoplasm, increased susceptibility to induced pancreatitis, respiratory system phenotype, liver/biliary system phenotype, gallstones Allele Detail: Targeted

  • From Current Category

Cite this (MGI Cat# 4888230, RRID:MGI:4888230)

Source Database: MGI, catalog # 4888230
Genetic Background: involves: 129S4/SvJaeSor * C57BL/6 * FVB/N
Affected Genes: Gt(ROSA)26Sor
Genomic Alteration: tm1Sor; Tg(Upk2-cre)6Xrw
Availability: Availability unknown check source stock center
Reference:
Notes: Allele Detail: Targeted, Transgenic

  • From Current Category

Cite this (MGI Cat# 5438801, RRID:MGI:5438801)

Source Database: MGI, catalog # 5438801
Genetic Background: involves: C3H/HeJ * C57BL/6 * CBA
Affected Genes: Tg(Camk2a-tTA)1Mmay
Genomic Alteration: Tg(Camk2a-tTA)1Mmay
Availability: Availability unknown check source stock center
Reference: PMID:22855807
Notes: hippocampal neuron degeneration, abnormal dentate gyrus morphology Allele Detail: Transgenic

  • From Current Category

Cite this (MGI Cat# 3721134, RRID:MGI:3721134)

Source Database: MGI, catalog # 3721134
Genetic Background: involves: 129P2/OlaHsd * C57BL/6
Affected Genes: Atf7, Atf2
Genomic Alteration: tm1Nicj; tm2Nicj
Availability: Availability unknown check source stock center
Reference: PMID:17699753
Notes: anemia, heart hypoplasia, hemopericardium, increased apoptosis, increased hepatocyte apoptosis, liver hypoplasia, decreased cell proliferation, abnormal liver morphology, abnormal common myeloid progenitor cell morphology, embryonic growth arrest, embryonic growth retardation, embryonic lethality during organogenesis, complete penetrance Allele Detail: Targeted

  • From Current Category

Cite this (MGI Cat# 2679502, RRID:MGI:2679502)

Source Database: MGI, catalog # 2679502
Genetic Background: Not Specified
Affected Genes: Eif2ak1
Genomic Alteration: tm1Jjch
Availability: Availability unknown check source stock center
Reference: PMID:11726526
Notes: extramedullary hematopoiesis, enlarged heart, abnormal erythrocyte osmotic lysis, macrocytic anemia, abnormal erythropoiesis, increased mean corpuscular volume, abnormal iron homeostasis, abnormal erythrocyte morphology, abnormal erythrocyte physiology, increased number of Heinz bodies, abnormal mean corpuscular hemoglobin Allele Detail: Targeted

  • From Current Category

Cite this (MGI Cat# 5007742, RRID:MGI:5007742)

Source Database: MGI, catalog # 5007742
Genetic Background: involves: 129P2/OlaHsd * C57BL/6 * FVB/N
Affected Genes: Cul9
Genomic Alteration: tm1.2Yxi
Availability: Availability unknown check source stock center
Reference: PMID:21487039
Notes: increased incidence of tumors by chemical induction, decreased body weight, decreased cellular sensitivity to gamma-irradiation, decreased cellular sensitivity to ultraviolet irradiation, increased liver tumor incidence, increased tumor incidence, premature death, increased sarcoma incidence, increased pituitary gland tumor incidence, cellular phenotype, increased lung tumor incidence, increased lymphoma incidence, increased ovary tumor incidence Allele Detail: Targeted

  • From Current Category

Cite this (MGI Cat# 3848530, RRID:MGI:3848530)

Source Database: MGI, catalog # 3848530
Genetic Background: involves: 129S1/Sv * 129X1/SvJ * C57BL/6J * DBA/2J
Affected Genes: Itgb1
Genomic Alteration: tm1Ref; Tg(KRT5-cre)5132Jlj; tm5.1Ref
Availability: Availability unknown check source stock center
Reference: PMID:16954348, PMID:19424505
Notes: abnormal hair follicle outer root sheath morphology, abnormal dermal layer morphology, abnormal dermal pigmentation, abnormal hair follicle morphology, blistering, abnormal hair growth, decreased hair follicle number, abnormal hair follicle morphology, abnormal coat/ hair morphology, sparse hair, reproductive system phenotype, decreased keratinocyte proliferation, progressive hair loss Allele Detail: Transgenic, Targeted

  • From Current Category

Cite this (WB Cat# IE43554, RRID:WB-STRAIN:IE43554)

Source Database: WB, catalog # IE43554
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00264792(ttTi43554)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (MGI Cat# 3688525, RRID:MGI:3688525)

Source Database: MGI, catalog # 3688525
Genetic Background: involves: C3HeB/FeJ * C57BL/6J
Affected Genes: Mc4r
Genomic Alteration: Y302C
Availability: Availability unknown check source stock center
Reference: PMID:16720677
Notes: increased susceptibility to weight gain, increased body weight Allele Detail: Chemically induced (ENU)

  • From Current Category

Cite this (MGI Cat# 3810268, RRID:MGI:3810268)

Source Database: MGI, catalog # 3810268
Genetic Background: involves: 129P2/OlaHsd
Affected Genes: Igkc, Igh-J
Genomic Alteration: tm1Jkbv; Tg(IGK@yK2)J23.1Jkbv; Tg(IGH@yH2BM)7Amgn
Availability: Availability unknown check source stock center
Reference:
Notes: abnormal immunoglobulin level, decreased B cell number Allele Detail: Targeted, Transgenic

  • From Current Category

Cite this (WB Cat# IE19283, RRID:WB-STRAIN:IE19283)

Source Database: WB, catalog # IE19283
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00258405(ttTi19283)
Availability: live
Reference: WBPaper00028894, WBPaper00040752
Notes: other notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (MGI Cat# 3617229, RRID:MGI:3617229)

Source Database: MGI, catalog # 3617229
Genetic Background: B6.129S1-C5ar2
Affected Genes: C5ar2
Genomic Alteration: tm1Cge
Availability: Availability unknown check source stock center
Reference: PMID:16204243
Notes: increased inflammatory response, abnormal immune cell physiology Allele Detail: Targeted

  • From Current Category

Cite this (MGI Cat# 3664664, RRID:MGI:3664664)

Source Database: MGI, catalog # 3664664
Genetic Background: involves: C58
Affected Genes: Tyrp1
Genomic Alteration: B-lt
Availability: Availability unknown check source stock center
Reference: PMID:15415586
Notes: abnormal coat/hair pigmentation, diluted coat color Allele Detail: Spontaneous

  • From Current Category

Cite this (WB Cat# IE10810, RRID:WB-STRAIN:IE10810)

Source Database: WB, catalog # IE10810
Genetic Background:
Affected Genes:
Genomic Alteration: WBVar00256405(ttTi10810)
Availability: live
Reference: WBPaper00040752, WBPaper00028894
Notes: other notes: For further information and strain requests please visit http://ums3421.univ-lyon1.fr/"|"Hermaphrodites carrying both the Mos1 transposon substrate and transposase extrachromosomal arrays were subjected to a heat-shock to induce transposase expression. Five days later, progeny of the F1 at the L4 stage carrying the Mos1 substrate array were singled. After a further 5 days of culture, worms of the F3 generation were transferred to fresh plates and 3 days later a single F4 worm that did not carry the Mos1 substrate array was transferred to a fresh plate. These worms were allowed to reproduce to give the F6 generation that was then subject to molecular characterization

  • From Current Category

Cite this (MGI Cat# 4941818, RRID:MGI:4941818)

Source Database: MGI, catalog # 4941818
Genetic Background: involves: C57BL/6J
Affected Genes: Sost
Genomic Alteration: tm1Lhe
Availability: Availability unknown check source stock center
Reference: PMID:19419300
Notes: increased bone mineral density, increased osteocyte number, decreased osteocyte apoptosis, abnormal osteoblast physiology, abnormal bone remodeling, abnormal osteoblast morphology, increased bone mass, decreased osteoblast apoptosis Allele Detail: Targeted

  • From Current Category

Cite this (WB Cat# VC3992, RRID:WB-STRAIN:VC3992)

Source Database: WB, catalog # VC3992
Genetic Background:
Affected Genes: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012646(lron-10)
Genomic Alteration:
Availability: live
Reference:
Notes: mutagen: Crispr/Cas9; outcrossed: x0; other notes: Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details."|"Made_by: Vancouver KO Group

  • From Current Category

  1. Resource Identification Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X