You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Organism Name
RRID:RGD_4139885 RRID Copied  
PDF Report How to cite
RRID:RGD_4139885
Copy Citation Copied
Organism Information

URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139885

Proper Citation: RRID:RGD_4139885

Description: Rattus norvegicus with name SS-Sh2b3em1Mcwi from RGD.

Species: Rattus norvegicus

Notes: This strain was produced by injecting ZFNs targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is an in-frame 6-bp deletion in exon 2.

Expand All
Usage and Citation Metrics
We apologize, the data for 2022 is currently unavailable for most resources. We are aware of the issue and are working to resolve it.

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

View full usage report

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for SS-Sh2b3em1Mcwi.

No alerts have been found for SS-Sh2b3em1Mcwi.

Data and Source Information

Source: Integrated Animals

Source Database: Rat Genome Database (RGD)