Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search

Type in a keyword to search

on page 1 showing 24 out of 8,811 results
http://www.addgene.org/115363

Cite This: RRID:Addgene_115363
Species:
Genetic insert: lacZ beta-D-galactosidase
Reference: PMID:15337849


Cite this (MGI Cat# 6202728, RRID:MGI:6202728)

Source Database: MGI, catalog # 6202728
Genetic Background: involves: 129P2/OlaHsd * FVB/N
Affected Genes: Ezh2, Ezh1
Genomic Alteration: Tg(MMTV-cre)1Mam; tm1Tara; tm1Jnw
Availability: Availability unknown check source stock center
Reference:
Notes: Allele Detail: Transgenic, Targeted


https://web.expasy.org/cellosaurus/CVCL_4783

Cite this: (ATCC Cat# CRL-3313, RRID:CVCL_4783)
Organism: Homo sapiens
Disease: Prostate carcinoma
Category: Cancer cell line
Comment: Characteristics: Derived from a tumor that developed in castrated nude mice injected with LNCaP cells. Derived from metastatic site: Left supraclavicular lymph node.


https://www.ncbi.nlm.nih.gov/biosample/SAMN10026416

Cite this: (IIDP, Cat# Pancreas-Scharp/Lacy-3051, RRID:SAMN10026416)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: David Scharp,The Scharp-Lacy Research Institute, Aliso Viejo, CA, 92656; Age: 49.00 Years; Submission Date: 2018-09-10T12:51:03.327; Status of tissue: live


http://antibodyregistry.org/AB_2755026

Cite this (MeruVasimmune Cat# MVI-1010, RRID:AB_2755026)
Comments: Applications: WB
References:
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): vWF


    Chemdraw

Cite this (Chemdraw, RRID:SCR_016768)

URL: http://www.perkinelmer.co.uk/category/chemdraw

Resource Type: Resource, software resource, software application

Software used to draw chemical structure. ChemDraw, along with Chem3D and ChemFinder, is part of the ChemOffice suite of programs and is available for Macintosh and Microsoft Windows.


http://www.addgene.org/115360

Cite This: RRID:Addgene_115360
Species:
Genetic insert: HA
Reference: PMID:15337849


Cite this (MGI Cat# 6188325, RRID:MGI:6188325)

Source Database: MGI, catalog # 6188325
Genetic Background: NOD.Cg-Lag3 Tg(Foxp3-EGFP/cre)1cJbs
Affected Genes: Lag3
Genomic Alteration: tm1Daav; Tg(Foxp3-EGFP/cre)1cJbs
Availability: Availability unknown check source stock center
Reference: PMID:28783703
Notes: decreased susceptibility to autoimmune diabetes, abnormal CD8-positive, alpha-beta T cell physiology, abnormal effector T cell number, abnormal interleukin level, abnormal tumor necrosis factor level Allele Detail: Transgenic, Targeted


https://web.expasy.org/cellosaurus/CVCL_7124

Cite this: (JCRB Cat# NIHS0049, RRID:CVCL_7124)
Organism: Homo sapiens
Disease: Ewing sarcoma
Category: Cancer cell line
Comment: Sequence variation: TP53 p.Cys176Phe (c.527G>T) (PubMed=8221663). Discontinued: JCRB; NIHS0049.


https://www.ncbi.nlm.nih.gov/biosample/SAMN10023853

Cite this: (IIDP, Cat# Pancreas-SCICRC-3050, RRID:SAMN10023853)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Fouad Kandeel,Southern California Islet Cell Resources Center, Duarte, CA, 91010; Age: 25.00 Years; Submission Date: 2018-09-09T20:11:03.534; Status of tissue: live


http://antibodyregistry.org/AB_2755024

Cite this (MeruVasimmune Cat# MVI-1008, RRID:AB_2755024)
Comments: Applications: Functional Blocking
References:
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): GPIIb/IIIa


    NEUBIAS

Cite this (NEUBIAS, RRID:SCR_016775)

URL: https://france-bioimaging.org/tag/neubias/

Resource Type: Resource, organization portal, portal, consortium, data or information resource

Network of European BioImage Analysts to advance life science imaging and to boost the productivity of bioimaging based research projects in Europe.


http://www.addgene.org/12523

Cite This: RRID:Addgene_12523
Species: H. sapiens (human)
Genetic insert: PIK3CA Myr
Reference: PMID:16339315


Cite this (MGI Cat# 6256504, RRID:MGI:6256504)

Source Database: MGI, catalog # 6256504
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: Availability unknown check source stock center
Reference:
Notes: Strain Type: Not Specified


https://web.expasy.org/cellosaurus/CVCL_RC64

Cite this: (ECACC Cat# 66540772, RRID:CVCL_RC64)
Organism: Homo sapiens
Disease:
Category: Induced pluripotent stem cell
Comment: From: StemBANCC; UK.


https://www.ncbi.nlm.nih.gov/biosample/SAMN09951470

Cite this: (IIDP, Cat# Pancreas-Scharp/Lacy-3049, RRID:SAMN09951470)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: David Scharp,The Scharp-Lacy Research Institute, Aliso Viejo, CA, 92656; Age: 51.00 Months; Submission Date: 2018-09-04T12:35:04.232; Status of tissue: live


http://antibodyregistry.org/AB_2755022

Cite this (MeruVasimmune Cat# MVI-1005, RRID:AB_2755022)
Comments: Applications: Functional Blocking
References:
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): Fibrinogen


Cite this (NamesForLife, RRID:SCR_016776)

URL: https://www.namesforlife.com/

Resource Type: Organization

Privately held Michigan based software company. They provide taxonomic and analytical services, data, software and technology licensing for the academic publishing industry, life sciences research, commercial partners and federal laboratories.


http://www.addgene.org/56356

Cite This: RRID:Addgene_56356
Species: H. sapiens (human)
Genetic insert: PDHA1
Reference: PMID:24094838


Cite this (WB Cat# VC3992, RRID:WB-STRAIN:VC3992)

Source Database: WB, catalog # VC3992
Genetic Background:
Affected Genes: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012646(lron-10)
Genomic Alteration:
Availability: live
Reference:
Notes: mutagen: Crispr/Cas9; outcrossed: x0; other notes: Homozygous viable. Deletion of 2073 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTGAGCACTGAACCAGCTTTTCGCCGCCT; Right flanking sequence: GATGGAGGTCATGCCTAAACGAAACAAAAA. See WormBase Variation gk5064 for details."|"Made_by: Vancouver KO Group


https://web.expasy.org/cellosaurus/CVCL_UB58

Cite this: (RRID:CVCL_UB58)
Organism: Homo sapiens
Disease:
Category: Induced pluripotent stem cell
Comment: Part of: Next Generation Genetic Association studies (Next Gen) program cell lines. From: Broeckel U.; Medical College of Wisconsin; USA. Population: Caucasian.


https://www.ncbi.nlm.nih.gov/biosample/SAMN09929594

Cite this: (IIDP, Cat# Pancreas-SCICRC-3047, RRID:SAMN09929594)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Fouad Kandeel,Southern California Islet Cell Resources Center, Duarte, CA, 91010; Age: 51.00 Years; Submission Date: 2018-08-28T18:10:04.355; Status of tissue: live


http://antibodyregistry.org/AB_2755035

Cite this (Cell Signaling Technology Cat# 99940, RRID:AB_2755035)
Comments: Applications: W, IHC-P
References:
Host Organism: rabbit
Clonality: monoclonal antibody
Target(s): CD3ε


    Leginon

Cite this (Leginon, RRID:SCR_016731)

URL: http://emg.nysbc.org/redmine/projects/leginon/wiki/Leginon_Homepage

Resource Type: Resource, data repository, data processing software, software application, service resource, portal, storage service resource, software resource, data acquisition software, data or information resource, image acquisition software

System designed for automated collection of images from a transmission electron microscope.


  1. Resource Identification Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X