Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search

Type in a keyword to search

on page 1 showing 24 out of 3,330,732 results

    pCoofy52

https://www.addgene.org/122006/

Cite This: RRID:Addgene_122006

Species:
Genetic insert:
Vector Backbone: pET
Reference: PMID:23410102
Comment: ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki . Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.


Cite this (IMSR Cat# TIGM:IST11160D5, RRID:IMSR_TIGM:IST11160D5)

Source Database: IMSR, catalog # TIGM:IST11160D5
Genetic Background:
Affected Genes: Mrps12
Genomic Alteration: Gt(IST11160D5)Tigm
Availability: mouse cells
Reference:
Notes: gene symbol note: mitochondrial ribosomal protein S12; unclassified: gene trap IST11160D5, Texas A&M Institute for Genomic Medicine


https://web.expasy.org/cellosaurus/CVCL_0252

Cite this: (RRID:CVCL_0252)
Organism: Rattus norvegicus
Disease:
Category: Spontaneously immortalized cell line
Comment:


https://www.ncbi.nlm.nih.gov/biosample/SAMN08482537

Cite this: (IIDP, Cat# 834, RRID:SAMN08482537)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Camilo Ricordi,University of Miami, Miami, FL, 33136; Age: 55.00 Years; Submission Date: 2018-02-07T18:06:03.360; Status of tissue: live


http://antibodyregistry.org/AB_2805687

Cite this (Thermo Fisher Scientific Cat# PA5-89612, RRID:AB_2805687)
Comments: Applications: WB (1:500-1:2000)
References:
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): TRAIL-R4


    Gobe

Cite this (Gobe, RRID:SCR_011802)

URL: http://try-gobe.appspot.com/

Resource Type: Resource, software resource

An interactive, web-based tool for comparative genomic visualization.


https://www.addgene.org/16798/

Cite This: RRID:Addgene_16798
fzd1; frizzled
Species: Rattus norvegicus
Genetic insert: Rfz1
Vector Backbone: pCS2+
Reference:
Comment: Constructed by: Julia Yang-Snyder (subclone), Jeff Brown (tags), 4/19/96.Rfz1 from Henk Roelink. This sequence has a few differences from the published sequence. Sites listed in Rfz1 are not a complete list. MYC tag version made by Jeff Brown (2/98-3/98), inserted the epitope into the StyI site (1904). The MYC epitope has a BglII site in it. The 3'Sty site is destroyed by the tags, but the 5' site is intact. Epitope can be detected in PBS/Formaldehyde fixed tissue permeabilized with 0.2% Triton.The Myc tagged Rfz1 has been IP'd from a TBS/1% Triton buffer. Frizzled tends to ppt out of SDS sample buffer when boiled, so either warm samplesto ~70 degrees Celsius for a few minutes before loading samples or use a strong denaturing loading buffer and incubate the samples at room temp for half an hour before loading. The StyI site is in the 3rd extracellular loop of the protein.


Cite this (ZFIN Cat# ZDB-GENO-121105-7, RRID:ZFIN_ZDB-GENO-121105-7)

Source Database: ZFIN, catalog # ZDB-GENO-121105-7
Genetic Background: AB
Affected Genes:
Genomic Alteration: mn0105Gt
Availability:
Reference:
Notes: ZFIN prefers authors to cite using the other (ZDB-ALT-prefixed) identifier.


https://web.expasy.org/cellosaurus/CVCL_1Y50

Cite this: (Coriell Cat# AG08471, RRID:CVCL_1Y50)
Organism: Homo sapiens
Disease:
Category: Finite cell line
Comment:


https://www.ncbi.nlm.nih.gov/biosample/SAMN08554602

Cite this: (IIDP, Cat# 8, RRID:SAMN08554602)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Camilo Ricordi,University of Miami, Miami, FL, 33136; Age: 61.00 Years; Submission Date: 2018-02-15T23:50:04.100; Status of tissue: live


http://antibodyregistry.org/AB_2300683

Cite this (Santa Cruz Biotechnology Cat# sc-160702, RRID:AB_2300683)
Comments: Discontinued: 2016; validation status unknown check with seller; recommendations: western blot, ELISA, immunocytochemistry
References:
Host Organism: goat
Clonality: polyclonal antibody
Target(s): RABIF


    Diaclone

Cite this (Diaclone, RRID:SCR_013526)

URL: http://www.diaclone.com/

Resource Type: Resource, material resource, reagent supplier, commercial organization, antibody supplier

An Antibody supplier


https://www.addgene.org/76720/

Cite This: RRID:Addgene_76720
MAPK9; NM_001135044.1
Species: Homo sapiens
Genetic insert: MAPK9
Vector Backbone: lentiGuide-Puro
Reference: PMID:26780180
Comment: The gRNA was designed to target the following Genbank reference sequence(s): NM_001135044.1,NM_002752.4,NM_139068.2,NM_139069.2,NM_139070.2. Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.


Cite this (RGD Cat# 1549797, RRID:RGD_1549797)

Source Database: RGD, catalog # 1549797
Genetic Background: congenic strain
Affected Genes:
Genomic Alteration:
Availability: live
Reference:
Notes: increased gastric adenocarcinoma incidence, increased incidence of tumors by chemical induction This congenic strain in the BUF background that has homozygous ACI chr16 was developed by the speed congenic method. National BioResource Project for the Rat in Japan


https://web.expasy.org/cellosaurus/CVCL_4917

Cite this: (RRID:CVCL_4917)
Organism: Sus scrofa
Disease:
Category: Undefined cell line type
Comment:


https://www.ncbi.nlm.nih.gov/biosample/SAMN08579888

Cite this: (IIDP, Cat# 18, RRID:SAMN08579888)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Fouad Kandeel,Southern California Islet Cell Resources Center, Duarte, CA, 91010; Age: 51.00 Years; Submission Date: 2018-02-21T16:15:03.793; Status of tissue: live


http://antibodyregistry.org/AB_2300709

Cite this (LifeSpan Cat# LS-C96147, RRID:AB_2300709)
Comments: vendor suggested use: ELISA
References:
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): RASD2


Cite this (Tip Calculator, RRID:SCR_013761)

URL: http://tips.com

Resource Type: Resource

calculates tips


https://www.addgene.org/91916/

Cite This: RRID:Addgene_91916

Species: Other
Genetic insert: PpCas13a and guide expression cassette
Vector Backbone: pACYC184
Reference: PMID:28976959
Comment:


Cite this (MGI Cat# 3828121, RRID:MGI:3828121)

Source Database: MGI, catalog # 3828121
Genetic Background: involves: 129S1/Sv * 129X1/SvJ * NZW
Affected Genes: Sall2
Genomic Alteration: tm1Jkoh
Availability: Availability unknown check source stock center
Reference: PMID:18818376
Notes: open neural tube, perinatal lethality, incomplete penetrance Allele Detail: Targeted


https://web.expasy.org/cellosaurus/CVCL_8026

Cite this: (RRID:CVCL_8026)
Organism: Cricetulus griseus
Disease:
Category: Spontaneously immortalized cell line
Comment:


https://www.ncbi.nlm.nih.gov/biosample/SAMN08498330

Cite this: (IIDP, Cat# 849, RRID:SAMN08498330)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Fouad Kandeel,Southern California Islet Cell Resources Center, Duarte, CA, 91010; Age: 63.00 Years; Submission Date: 2018-02-08T08:56:22.143; Status of tissue: live


http://antibodyregistry.org/AB_2301224

Cite this (BioVision Cat# 3278-100, RRID:AB_2301224)
Comments: Useful for western blot
References:
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): RPS6KA5


Cite this (University of Vigo; Galicia; Spain, RRID:SCR_011742)

URL: http://www.uvigo.es/uvigo_en/

Resource Type: Resource, university, institution


  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X