Searching across hundreds of databases

Our searching services are busy right now. Your search will reload in five seconds.

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Search

Type in a keyword to search

on page 1 showing 24 out of 3,321,003 results

    B1-1

https://www.addgene.org/111463/

Cite This: RRID:Addgene_111463

Species: Other
Genetic insert: Val-tRNA synthetase
Vector Backbone: pSC101
Reference: PMID:29131146
Comment: Gene comes from E.coli.


Cite this (IMSR Cat# KOMP:CSD80238-1a-Wtsi, RRID:IMSR_KOMP:CSD80238-1a-Wtsi)

Source Database: IMSR, catalog # KOMP:CSD80238-1a-Wtsi
Genetic Background:
Affected Genes: Tgm6
Genomic Alteration: tm1a(KOMP)Wtsi
Availability: mouse cells
Reference:
Notes: gene symbol note: transglutaminase 6; mutant strain: targeted mutation 1a, Wellcome Trust Sanger Institute


https://web.expasy.org/cellosaurus/CVCL_8W19

Cite this: (ECACC Cat# 96082302, RRID:CVCL_8W19)
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 4
Comment: Part of: ECACC chromosomal abnormality collection. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 23-02-16; Last updated: 07-09-18; Version: 4


https://www.ncbi.nlm.nih.gov/biosample/SAMN08634085

Cite this: (IIDP, Cat# 1991, RRID:SAMN08634085)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: Human pancreatic islets were isolated using standardized procedures established at each manufacturing laboratory. Preparations were then distributed through the IIDP for use in scientific studies.; Provider: Luis Fernandez,University of Wisconsin, Madison, WI, 53705-2275; Age: Missing; Submission Date: 2018-03-04T09:16:03.723; Status of tissue: live


http://antibodyregistry.org/AB_10514269

Cite this (GenWay Biotech Inc. Cat# GWB-F1E419, RRID:AB_10514269)
Comments: manufacturer recommendations: IgG ELISA; ELISA
References:
Host Organism: goat
Clonality: polyclonal antibody
Target(s): Goat Human CTDP1


Cite this (Catalogue for Transmission Genetics in Arabs, RRID:SCR_000730)

URL: http://www.cags.org.ae

Resource Type: Resource, data or information resource, database

The CTGA database is a database for genetic disorders in Arab populations. It hosts entries for Mendelian disorders and related genes, and currently contains nearly 1290 entries. Its goal is to facilitate further research on Arab genomic diseases.


https://www.addgene.org/120595/

Cite This: RRID:Addgene_120595

Species: Other
Genetic insert: Smp_194920
Vector Backbone: pTT3
Reference:
Comment:


Cite this (IMSR Cat# TIGM:IST13716F4, RRID:IMSR_TIGM:IST13716F4)

Source Database: IMSR, catalog # TIGM:IST13716F4
Genetic Background:
Affected Genes: Ppp2r2d
Genomic Alteration: Gt(IST13716F4)Tigm
Availability: mouse cells
Reference:
Notes: gene symbol note: protein phosphatase 2, regulatory subunit B, delta; unclassified: gene trap IST13716F4, Texas A&M Institute for Genomic Medicine


https://web.expasy.org/cellosaurus/CVCL_8W20

Cite this: (ECACC Cat# 96091307, RRID:CVCL_8W20)
Organism: Homo sapiens
Disease:
Category: Transformed cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 4
Comment: Part of: ECACC chromosomal abnormality collection. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 23-02-16; Last updated: 07-09-18; Version: 4


https://www.ncbi.nlm.nih.gov/biosample/SAMN08612556

Cite this: (IIDP, Cat# 1973, RRID:SAMN08612556)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Luis Fernandez,University of Wisconsin, Madison, WI, 53705-2275; Age: 53.00 Years; Submission Date: 2018-02-27T00:55:04.663; Status of tissue: live


http://antibodyregistry.org/AB_1051416

Cite this (LifeSpan Cat# LS-C44932-200, RRID:AB_1051416)
Comments: vendor suggested use: Flow Cytometry; Immunohistochemistry; Immunoprecipitation; Flow Cytometry (1:25 - 1:100), Immunoprecipitation
References:
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): Human CD44 Antigen (homing Function And Indian Blood Group System) (CD44)


Cite this (Transposon Insertion Finder, RRID:SCR_001159)

URL: https://github.com/akiomiyao/tif

Resource Type: Resource, software resource

A search program to detect insertions of transposable element from short reads of next generation sequencer.


https://www.addgene.org/62733/

Cite This: RRID:Addgene_62733

Species: Synthetic
Genetic insert: CRISPR-SP-Cas9 target seq + tdTomato (out of frame)
Vector Backbone: PHAGE2
Reference: PMID:25910214
Comment:


Cite this (DGGR Cat# 118158, RRID:DGGR_118158)

Source Database: DGGR, catalog # 118158
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: Available
Reference:
Notes:


https://web.expasy.org/cellosaurus/CVCL_8X31

Cite this: (ECACC Cat# 89061426, RRID:CVCL_8X31)
Organism: Homo sapiens
Disease:
Category: Finite cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 2
Comment: Part of: ECACC chromosomal abnormality collection. DT Created: 23-02-16; Last updated: 07-09-18; Version: 2


https://www.ncbi.nlm.nih.gov/biosample/SAMN08498329

Cite this: (IIDP, Cat# 851, RRID:SAMN08498329)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Camilo Ricordi,University of Miami, Miami, FL, 33136; Age: 51.00 Years; Submission Date: 2018-02-08T08:56:21.646; Status of tissue: live


http://antibodyregistry.org/AB_10514174

Cite this (GenWay Biotech Inc. Cat# 18-003-42066, RRID:AB_10514174)
Comments: manufacturer recommendations: IgG Immunohistochemistry-P, Western Blot; Immunohistochemistry; Western Blot
References:
Host Organism: rabbit
Clonality: polyclonal antibody
Target(s): Rabbit Human AEBP1


    freeIbis

Cite this (freeIbis, RRID:SCR_001241)

URL: https://github.com/grenaud/freeIbis

Resource Type: Resource, software resource

A software basecaller for Illumina sequencers with calibrated quality scores.


https://www.addgene.org/11664/

Cite This: RRID:Addgene_11664
firefly luciferase hairpin
Species: Firefly
Genetic insert: FF3
Vector Backbone: pPRIME-CMV-dsRed
Reference: PMID:16141338
Comment: CMV promoter transcribes dsRed and miR30-based shRNA targeting FF3. The FF3 hairpin can be replaced with any other hairpin by cloning into the EcoR1/Xho1 site.Please note that the full plasmid sequence shown here is for the empty vector only and does not contain the FF3 targeting sequence (AGCTCCCGTGAATTGGAATCCTAGTGAAGCCACAGATGTAGGATTCCAATTCAGCGGGAGCC)


Cite this (IMSR Cat# TIGM:IST14606B3, RRID:IMSR_TIGM:IST14606B3)

Source Database: IMSR, catalog # TIGM:IST14606B3
Genetic Background:
Affected Genes: Calca
Genomic Alteration: Gt(IST14606B3)Tigm
Availability: mouse cells
Reference:
Notes: gene symbol note: calcitonin/calcitonin-related polypeptide, alpha; unclassified: gene trap IST14606B3, Texas A&M Institute for Genomic Medicine


https://web.expasy.org/cellosaurus/CVCL_8W21

Cite this: (ECACC Cat# 97102213, RRID:CVCL_8W21)
Organism: Homo sapiens
Disease: Triple A syndrome
Category: Transformed cell line DT Created: 23-02-16; Last updated: 07-09-18; Version: 4
Comment: Part of: ECACC chromosomal abnormality collection. Transformant: NCBI_TaxID; 10376; Epstein-Barr virus (EBV). DT Created: 23-02-16; Last updated: 07-09-18; Version: 4


https://www.ncbi.nlm.nih.gov/biosample/SAMN08612554

Cite this: (IIDP, Cat# 1970, RRID:SAMN08612554)
Organism: Homo sapiens
Disease: Diabetes
Category: Tissue: Pancreas
Comment: IIDP Submission for Human Islets; Provider: Camilo Ricordi,University of Miami, Miami, FL, 33136; Age: 51.00 Years; Submission Date: 2018-02-27T00:00:09.733; Status of tissue: live


http://antibodyregistry.org/AB_10514177

Cite this (GenWay Biotech Inc. Cat# GWB-7BB02A, RRID:AB_10514177)
Comments: manufacturer recommendations: IgG Flow Cytometry; Immunofluorescence; FACS, Immunofluorescence
References:
Host Organism: mouse
Clonality: monoclonal antibody
Target(s): Mouse Human CD20


    Gzip

Cite this (Gzip, RRID:SCR_009291)

URL: http://www.gzip.org/

Resource Type: Resource, software resource

A compression utility designed to be a replacement for compress.


  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X