You are being redirected to the external resource authority website. If you haven't been redirected in 10 seconds, please click http://www.wormbase.org/db/get?name=WBStrain00035593.

For additional information about this resource, such as mentions, alerts, rating and validation information, please view our Resource Report (shown below).


Organism Name
RRID:WB-STRAIN:WBStrain00035593 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00035593
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00035593

Proper Citation: RRID:WB-STRAIN:WBStrain00035593

Description: Caenorhabditis elegans with name cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. from WB.

Species: Caenorhabditis elegans

Synonyms: cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V.

Notes: Mutagen:UV/TMP|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Affected Gene: WBGene00000553(cmk-1)|WBGene00044213(Y102A5C.36)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.total_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for VC220.

No alerts have been found for VC220.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)