URL: http://www.addgene.org/83481
Proper Citation: RRID:Addgene_83481
Insert Name: SpCas9
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Marker:Eric Lander, David Sabatini; Backbone Size:11900; Vector Backbone:pCW-Cas9 (#50661); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Comments: Blasticidin gene was amplified from lentiCas9-Blast using primers F: TCTCCCCAGCAATTCACCatggccaagcctttgtctc, R: CAAGTGAGGAGAGAACCTCTACCTTCttagccctcccacacataacc. The PCR product was gel-purified and used to perform CPEC cloning on pCW-Cas9, as described in 21293463. Because a previous version of this plasmid contained a STOP codon between the blasticidin resistance gene and rtTA, this stop codon was subsequently removed. The following primers were used to confirm removal of the STOP codon: Forward primer: GTGTTCCGCATTCTGCAAG Reverse primer: ACGTGCCAGTACAGGGTAGG
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pCW-Cas9-Blast.
No alerts have been found for pCW-Cas9-Blast.
Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org