URL: http://www.addgene.org/72876
Proper Citation: RRID:Addgene_72876
Insert Name: NDI1
Organism: Saccharomyces cerevisiae
Bacterial Resistance: Ampicillin
Defining Citation: PMID:24670634
Vector Backbone Description: Backbone Size:5639; Vector Backbone:pMXs-IRES-blasticidin; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: The retroviral NDI1 vector was generated by cloning into the EcoRI and XhoI sites of the pMXS-ires-blast vector a cDNA insert generated by PCR using the primers below, followed by standard cloning techniques. Ndi1 EcoRI F: ATGAATTCCATCACATCATCGAATTAC Ndi1 XhoI R: ATCTCGAGAAAAGGGCATGTTAATTTCATCTATAAT It is a retroviral plasmid so it may be recommended to be propagated at 30oc but author typically grows it at 37oC.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
Find mentions based on location
{{ ctrl2.mentions.errors.location }}
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for PMXS-NDI1.
No alerts have been found for PMXS-NDI1.
Source: Addgene